Cfx384 machine

Manufactured by Bio-Rad

Sourced in United States

The CFX384 machine is a real-time PCR detection system designed for high-throughput nucleic acid analysis. It features 384-well sample capacity and multiple fluorescence detection channels to enable simultaneous analysis of multiple targets or samples. The system provides precise temperature control and advanced data analysis software for accurate and efficient real-time PCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

40 protocols using cfx384 machine

Quantifying Oxytocin Expression in Mouse Hypothalamus

Check if the same lab product or an alternative is used in the 5 most similar protocols

On PND 90, naïve mice that were littermates of those tested in the behavioral studies were sacrificed and the hypothalamus was removed when the ventral surface was exposed. In order to isolate OT RNA we homogenized brain tissues using Precellys Lysing Kit (Ref. KT03961-1-993.2). Then the tissues were run for 30 s twice in a homogenizer (maximum speed) (Minilys^®, Bertin Instruments) and RNA was isolated using Biological Industries EZ-RNA II kit, following its protocol. For reverse transcription, we used QIAGEN QuantiTect Reverse Transcription Kit (Ref. 205311), using the recommended kit protocol. We reverse-transcribed 200 ng RNA to cDNA. Finally, for quantitative PCR (qPCR) we used BioRad SsoAdvanced Universal SYBR Green Supermix (Cat. No. 172-5271) kit and BioRad CFX384 machine, following the kit protocol:

95 °C, 5 min

95 °C, 15 s

60 °C, 30 s

Repeat steps 2–3 for 39 more times

Melting curve: 65–95 °C, .5 °C increments, 5 s/step.

Each qPCR reaction final volume was 12 μl, with cDNA equivalent to 10 ng RNA, and primer concentrations of 300 nM each. Each combination of a sample and a primer set ran in triplicates. Primer sequences for OT were: Forward-GAC CTG GAT ATG CGC AAG TGT and reverse-GAA GCA GCC CAG CTC GTC. The sequences of the ‘housekeeping’ gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were: Forward-AGA GAC AGC CGC ATC TTC TTG and reverse-GTA ACC AGG CGT CCG ATA CG.

Lan A., Stein D., Portillo M., Toiber D, & Kofman O. (2019). Impaired innate and conditioned social behavior in adult C57Bl6/J mice prenatally exposed to chlorpyrifos. Behavioral and Brain Functions : BBF, 15, 2.

+ Open protocol

+ Expand

Fibrosis Marker Expression Analysis in Posterior Capsule

Check if the same lab product or an alternative is used in the 5 most similar protocols

Posterior capsular tissue was harvested from each limb utilized for biomechanical analysis. At time of harvest, tissues were placed in RNAlater (Ambion, Inc.; Austin, Texas) and stored at −20°C. Total RNA was extracted utilizing a standard kit (QIAGEN; Germantown, Maryland) and converted to complimentary DNA. Quantitative PCR was performed using a CFX384 machine (BIO-RAD, Hercules, California) with 10 ng cDNA per 10 μl using the QuantiTect SYBR Green PCR Kit (QIAGEN). Samples were analyzed as biological triplicates using the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) housekeeping gene as a reference. Collagenous, non-collagenous, matrix metalloproteinases and myofibroblastic markers of fibrosis were studied (Supplementary Table 1).

Owen A.R., Dagneaux L., Limberg A.K., Bettencourt J.W., Bayram B., Bolon B., Berry D.J., Morrey M.E., Sanchez-Sotelo J., van Wijnen A.J, & Abdel M.P. (2021). Biomechanical, Histological, and Molecular Characterization of a New Post-traumatic Model of Arthrofibrosis in Rats. Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 40(2), 323-337.

+ Open protocol

+ Expand

Quantitative Analysis of Sphingolipid Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cell samples using a GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich). cDNA was synthesized by using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific), and the abundance of target RNAs in cDNA was quantitated by TaqMan assay or SYBR green assay. For the TaqMan assay, primer pairs and probes for human SPHK1 and β-actin were obtained from the TaqMan assay reagent library of Thermo Fisher Scientific, and the abundance of each RNA was determined as described previously^{59 (link)}. For the SYBR green assay, qRT-PCR was performed on a CFX384 machine (Bio-Rad, Hercules, CA) using SYBR Green Master Mix (Thermo Fisher Scientific). The sequences of primers used for real-time PCR are listed in supplemental Table S1 for human SPHK1, SPHK2, S1P lyase, S1P₁, S1P₂, and S1P₃, and β-actin. The abundance of each RNA was determined by using the comparative threshold cycle method^{60 (link)}.

Funaki M., Kitabayashi J., Shimakami T., Nagata N., Sakai Y., Takegoshi K., Okada H., Murai K., Shirasaki T., Oyama T., Yamashita T., Ota T., Takuwa Y., Honda M, & Kaneko S. (2017). Peretinoin, an acyclic retinoid, inhibits hepatocarcinogenesis by suppressing sphingosine kinase 1 expression in vitro and in vivo. Scientific Reports, 7, 16978.

+ Open protocol

+ Expand

Quantification of SARS-CoV-2 Spike Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA samples were prepared using a Quick-RNA Mini-Prep (ZYMO research, Cat #: R1055). RNAs were then reverse-transcribed into complementary DNAs using iScript Reverse Transcription Supermix (Bio-Rad, Cat #: 1708841). The relative abundance of Spike transcripts was quantified by quantitative real-time PCR (qPCR) using CFX384 machine (Bio-Rad) with a fluorescence reporter (Thermo Fisher Scientific, Maxima SYBR Green/ROX, Cat #: K0223) and a pair of Spike-Flag specific primers (forward: GGTGCTGACTGAGAGCAATAA, reverse: CACATTAGAGCCGGTTGAGTAG, designed by using PrimerQuest (IDT)), which was quantified by calculating the 2^−ΔCt (normalized by the relative signals corresponding to β-actin in a separate qPCR). A robust ORF8-Strep transcription was confirmed by RT-qPCR in cells transfected for co-expressing Spike-Flag and ORF8-Strep.

Kim I.J., Lee Y.H., Khalid M.M., Chen I.P., Zhang Y., Ott M, & Verdin E. (2023). SARS-CoV-2 protein ORF8 limits expression levels of Spike antigen and facilitates immune evasion of infected host cells. The Journal of Biological Chemistry, 299(8), 104955.

+ Open protocol

+ Expand

Quantitative RT-PCR analysis of liver mRNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from frozen liver samples using a GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich). cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA). Quantitative real-time PCR (qPCR) was then performed on a CFX384 machine (Bio-Rad, Hercules, CA, USA) using SYBR Green Master Mix, as described previously26 (link). The primers used for real-time PCR are shown in Table S4. The mRNA expression levels in the groups were normalized to those of NC-fed mice.

Ni Y., Nagashimada M., Zhuge F., Zhan L., Nagata N., Tsutsui A., Nakanuma Y., Kaneko S, & Ota T. (2015). Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E. Scientific Reports, 5, 17192.

+ Open protocol

+ Expand

Quantitative PCR with SYBR Green

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantitative PCR was performed using a BioRad CFX-384 machine. 15 μL reactions were prepared, each containing 7.5 μL of Applied Biosystems SYBR Select Master Mix, 4.5 μL 3.3M betaine, 1.2 μL of 2.5 μM oligo mix, 0.8 μL water, and 1 μL template. The thermocycler protocol was: 2 min at 50°C then 2 min at 95°C followed by 40 cycles of 15 s at 95°C and then 1 min at 60°C followed by a plate read. Lastly a melt curve was generated. Standards were generated with five fold dilutions of genomic DNA containing templates for all PCR products.

Greenstein R.A., Jones S.K., Spivey E.C., Rybarski J.R., Finkelstein I.J, & Al-Sady B. (2018). Noncoding RNA-nucleated heterochromatin spreading is intrinsically labile and requires accessory elements for epigenetic stability. eLife, 7, e32948.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from subconfluent monolayers of cancer cells using the RNeasy RNA isolation kit (Qiagen), and cDNA synthesis was performed using oligo(dT) primers and M-MLV reverse transcriptase (Invitrogen). RT-qPCR was performed in triplicate wells using iTaq Universal SYBR Green Supermix (Bio-Rad). Primers used in this study were purchased from Sigma Aldrich and are listed in Supplemental Table S2. Analysis of real-time data was collected using a Bio-Rad CFX384 machine and CFX Maestro software. Expression levels of each gene were normalized to 18S or GAPDH control housekeeping genes using the ddCT algorithm.

Hoj J.P., Mayro B, & Pendergast A.M. (2019). A TAZ-AXL-ABL2 feed-forward signaling axis promotes lung adenocarcinoma brain metastasis. Cell reports, 29(11), 3421-3434.e8.

+ Open protocol

+ Expand

Expression Analysis of Inflammation Mediators

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of GPR120, μ-calpain, IL-1β, IL-6, tumor necrosis factor, and too-like receptor-4 was analyzed by using quantitative real-time PCR, which was performed on a CFX384 machine (Bio-Rad, Hercules, CA) using SYBR Green Master Mix (Applied Biosystems). Total RNA was extracted from cultured cells using High Pure RNA Isolation Kit (Roche Diagnostics K.K., Tokyo, Japan) according to the manufacturer's protocol. cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA). Each sample was determined in triplicate and normalized relative to β-actin expression. The following probes were used: GPR120 (Hs00699184_m1), μ-calpain (Hs00559804_m1), IL-1β (Mm01336189_ml), IL-6 (Mm00446190_ml), tumor necrosis factor (Mm00443258_ml), and toll-like receptor-4 (Mm00445273).

Seike T., Boontem P., Yanagi M., Li S., Kido H., Yamamiya D., Nakagawa H., Okada H., Yamashita T., Harada K., Kikuchi M., Shiraishi Y., Ozaki N., Kaneko S., Yamashima T, & Mizukoshi E. (2022). Hydroxynonenal Causes Hepatocyte Death by Disrupting Lysosomal Integrity in Nonalcoholic Steatohepatitis. Cellular and Molecular Gastroenterology and Hepatology, 14(4), 925-944.

+ Open protocol

+ Expand

Gene Expression Quantification in Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Seedlings were frozen in liquid nitrogen and ground with glass beads using a Silamat S5 device (Ivoclar Vivadent) for 10 s. RNA was extracted using TRIzol reagent and treated with DNAse I according to manufacturer instructions (ThermoFisher Scientific). One µg of total RNA was used as template for reverse transcription using iScript Reverse Transcription Supermix as recommended by the manufacturer (BioRad). qPCR was performed with iTaq Universal SYBR®Green Supermix (BioRad) and primers listed in Supplementary Table 1, in a CFX384 machine (BioRad). Gene expression levels were compared to the reference gene GAPC-2 (At1g13440), ACT2 (At3g18780) or IPP2 (At3g02780).

Vergara Z., Gomez M.S., Desvoyes B., Sequeira-Mendes J., Masoud K., Costas C., Noir S., Caro E., Mora-Gil V., Genschik P, & Gutierrez C. (2023). Distinct roles of Arabidopsis ORC1 proteins in DNA replication and heterochromatic H3K27me1 deposition. Nature Communications, 14, 1270.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Mouse Ovarian Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

One frozen ovary per mouse was homogenized using a Retsch mixer Mill MM 400. Total RNA was extracted using RNeasy Mini kit (Qiagen, 74104) followed by DNase I treatment (Qiagen, 79254) to ensure the complete removal of any DNA contamination. RNA concentration and purity were measured using the NanoDrop 2000 spectrophotometer (ThermoFisher Scientific). Five hundred nanogram of RNA were subsequently reverse transcribed to cDNA using a SuperScript III First-Strand synthesis kit (ThermoFisher Scientific, 18080051). A Bio-Rad CFX384 machine was used for quantitative real-time PCR using the 2x QuantiNova SYBR Green PCR Master Mix as described by the manufacturer (Qiagen, 208052). GAPDH was used as the endogenous control. Results are expressed as fold change in expression compared to 2-month-old WT mice and were calculated using the 2^−ΔΔCt method. The thermal cycling conditions used for 2x QuantiNova SYBR Green PCR Master Mix were 2 min at 95°C, followed by 40 cycles of 5 s at 95°C and 10 s at 60°C. The specificity of the process was controlled by Melting Curve analyses. The primers used in this study are detailed in Supplementary Table 2.

Lliberos C., Liew S.H., Mansell A, & Hutt K.J. (2021). The Inflammasome Contributes to Depletion of the Ovarian Reserve During Aging in Mice. Frontiers in Cell and Developmental Biology, 8, 628473.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!