Endothelial progenitor cells were isolated and characterized as previously described.18 , 19 Peripheral blood mononuclear cells, which were isolated using a Ficoll‐Isopaque Plus (Histopaque‐1077; Sigma) gradient centrifugation method, were seeded in fibronectin‐coated cell culture flasks. Then, the cells were cultured with Endothelial Basal Medium‐2 (EBM‐2; Lonza) in a 37°C, 5% CO2 incubator. Culture media were replaced after 4 days of incubation. Late EPCs grow into cobble‐stone‐like colonies after 14 days of incubation. The presence of EPCs was validated by both confocal microscopy and flow cytometry as previously described.20 , 21 EPCs were identified by double‐positive for DiI‐Ac‐LDL and UEA‐1. Surface makers, including CD31, CD34, CD45, CD133 and CD309 (Becton‐Dickinson), were analysed for the definition of EPCs. The EPCs from 3 to 5 passages were used.
Cd133
Manufactured by BD
Sourced in United States
CD133 is a cell surface glycoprotein that is commonly used as a marker for stem cells and cancer stem cells. It is involved in cell adhesion and signal transduction. CD133 is expressed on a variety of cell types, including hematopoietic stem cells, endothelial progenitor cells, and some cancer cell populations.
Automatically generated - may contain errors
Lab products found in correlation
Hla dr, by BD (4 mentions)
Cd105, by BD (4 mentions)
Sodium azide, by Merck Group (3 mentions)
Epcam, by BD (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Facscalibur flow cytometer, by BD (2 mentions)
Intracellular samhd1, by Abcam (2 mentions)
Ethylene diamine tetraacetic acid (edta), by Thermo Fisher Scientific (2 mentions)
Cyan adp analyzer, by Beckman Coulter (2 mentions)
β actin, by Santa Cruz Biotechnology (2 mentions)
Cd166, by BD (2 mentions)
Hla class 1, by BD (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Cd309, by BD (1 mentions)
Ebm 2, by Lonza (1 mentions)
Cd56 apc, by BD (1 mentions)
Ccr7 pe cy7, by BD (1 mentions)
Cd62l pe, by BD (1 mentions)
Cd8 pe, by BD (1 mentions)
28 protocols using cd133
1
Isolation and Characterization of Endothelial Progenitor Cells
2
Multiparametric Flow Cytometry Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Evaluation of CAR expression was performed by staining with a goat anti-mouse Fab antibody (Jackson ImmunoResearch, USA). In addition, the following anti-human antibodies were also used in this study: CD133 (phycoerythrin, PE), CD3 (chlorophyll protein complex PerCP), CD4 (fluorescein isothiocyanate, FITC), CD8-PE, CD45RO (allophycocyanin, APC), CD56-APC, CD62 L-PE, and CCR7-PE-Cy7 were purchased from Becton Dickinson. Isotype-matched control mAbs were applied in all the procedures. FACS data were analyzed by a FACS Calibur flow cytometer (BD Biosciences) and FlowJo software (Version 10.0.7, FlowJo, Ashland, OR).
3
Isolation and Characterization of Rat BM-MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary BM-MSCs were gained from the femoral cavity of 80-100 g male Sprague Dawley rats and cultured according to standard protocols [16 (link)]. The cells were rinsed twice with PBS and cultured in low-glucose Dulbecco's modified Eagle's medium (HyClone, China), 10% fetal bovine serum (Excell, Australia), and 100 U/ml penicillin and streptomycin (Shandong, China) at 37°C in a humid 5% CO2 air atmosphere. After 4 days, nonadherent cells were discarded by adding a new culture medium. When BM-MSCs reached 80% confluence, they were trypsinized with 0.25% trypsin (Biological, USA) and cultured for further expansion. All BM-MSCs used in this study were third generation. The phenotypes of BM-MSCs were tested by Attune NxT (Invitrogen, USA) after labeled with fluorochrome-conjugated antibodies, including CD29, CD44, CD90, CD105, CD34, CD45, CD133, and HLA-DR (Becton, USA). For evaluation of differentiation capacity, third-passage BM-MSCs were pretreated with adipogenic and osteogenic induction medium (Cyagen, China). The adipocytes were then stained with Oil Red O (Cyagen, China) and alkaline phosphatase (Shanghai, China) to assess adipogenic and osteogenic differentiation.
4
Cell Cycle, Apoptosis, and CSC Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell cycle and apoptosis analyses were performed by FACS. To detect the cell cycle, 1 × 105 lentivirus-transduced CRC cells were seeded into one well of a 6-well plate and cultured for 24 h. The cells were labeled with 10 μM EdU for 2 h, digested with trypsin, fixed and stained with an EdU staining kit (BeyoClick EdU cell proliferation kit) with Alexa Fluor 488 (C0071, Beyotime) and 7-amino-actinomycin (7-AAD; 559925, BD) following the manufacturers’ protocols. For apoptosis analysis, 1.5 × 106 lentivirus-transduced CRC cells were digested with trypsin and stained with Annexin-V (88-8007-74, Invitrogen) and 7-AAD (559925, BD) for 30 min in the dark. For CSC markers detection, 1.5 × 106 lentivirus-transduced CRC cells were digested with trypsin and stained with CD44 (BioLegend, 397505), CD133 (566593, BD) and CD166 (BioLegend, 343905) for 30 min in the dark. A MoFlo Astrios Flow Cytometer (Beckman) was used for flow cytometry analyses.
5
Sorting of CD44+/CD133+ Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For sorting cells, cells were dissociated with Accutase (Stem Cell Technologies, Vancouver, Canada), washed twice with PBS and processed for CD44 (Miltenyi Biotec, Cologne, German) and CD133 (Miltenyi Biotec, Cologne, German) multicolor staining, along with appropriate negative controls and single‐color positive controls. The CD44+/CD133+ populations were sorted out by a BD FACS Diva cell sorter (BD, USA).
6
Apoptosis and Stem Cell Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The samples were processed according to the manufacturer’s protocol using Annexin-V/PI Apoptosis Kit (Yisheng Technology, Shanghai, China), detected using a FACS Calibur flow cytometer (BD, USA), and the data were processed with FlowJo software.
For hepatocellular carcinoma stem cell expression assay, the cells were incubated with CD44 (BD, USA), and CD133 (BD, USA) for 20 minutes at room temperature and protected from light, and the cell suspensions were filtered with a 40 mm single-cell sieve before going on the machine and detected using a FACS Calibur flow cytometer (BD, USA), and the data were processed with FlowJo software.
For hepatocellular carcinoma stem cell expression assay, the cells were incubated with CD44 (BD, USA), and CD133 (BD, USA) for 20 minutes at room temperature and protected from light, and the cell suspensions were filtered with a 40 mm single-cell sieve before going on the machine and detected using a FACS Calibur flow cytometer (BD, USA), and the data were processed with FlowJo software.
7
Characterization of Hematopoietic Stem and Progenitor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HSPCs and monocytes were incubated with PBS containing 2% FBS, 2 mM EDTA (Invitrogen Life Technologies) and 0.1% sodium azide (Sigma-Aldrich) for staining cell surface markers. Intracellular SAMHD1 (Abcam, Cambridge, UK) staining was performed as described (Baldauf et al., 2012 (link)). Depending on the purpose of the experiment, the following antibodies were used for staining HSPCs in various combinations: Lin-, CD34, CD133, and CD38 (BD Biosciences, San Jose). Samples were acquired on a CyAn™ ADP Analyzer (Beckman Coulter, Pasadena, CA) and analyzed by FlowJo software (TreeStar, Ashland, OR). Gating strategy is shown in Fig. 2A .
8
STAT3 Knockdown and Mitochondrial Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For STAT3 knockdown using siRNA, following targeting ON-TARGETplus set of 4 SiRNA sequences (Dharmacon, USA) were used: 1. GAGAUUGACCAGCAGUAUA, 2. CAACAUGUCAUUUGCUGAA, 3. CCAACAACCCAAGAAUGU, 4. CAACAGAUUGCCUGCAUUG
The following primers were used to check mitochondrial DNA copy no: mtDNA, Forward primer: CCTCCTCCTAGCAGCAGC, Reverse primer: GGTTGTGGATGATGGACCCG; HPRT, Forward primer: CCTGGGGATTCCAAATACCT, Reverse primer: GGGCAGAAAAGGTCATCAAA.
The following antibodies were used for immunoblotting: S727STAT3, STAT3 (Cell signaling, USA), GAPDH, β-actin, and VDAC-1 (Santa-Cruz, Dallas, TX), Y705STAT3, OXPHOS cocktail antibody, mtTFA, PGC1α, NDUFA9, GRIM19 (Abcam, Cambridge, UK), CD44, CD24, CD133 (BD Bioscience), FLAG, HA (Sigma-Aldrich, USA)
The following primers were used to check mitochondrial DNA copy no: mtDNA, Forward primer: CCTCCTCCTAGCAGCAGC, Reverse primer: GGTTGTGGATGATGGACCCG; HPRT, Forward primer: CCTGGGGATTCCAAATACCT, Reverse primer: GGGCAGAAAAGGTCATCAAA.
The following antibodies were used for immunoblotting: S727STAT3, STAT3 (Cell signaling, USA), GAPDH, β-actin, and VDAC-1 (Santa-Cruz, Dallas, TX), Y705STAT3, OXPHOS cocktail antibody, mtTFA, PGC1α, NDUFA9, GRIM19 (Abcam, Cambridge, UK), CD44, CD24, CD133 (BD Bioscience), FLAG, HA (Sigma-Aldrich, USA)
9
Characterization of Hematopoietic Stem and Progenitor Cells
10
Identification of CD133 and ALDH1 Subpopulations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1 × 106 cells were harvested and washed in PBS three times. Then, the cells were resuspended in 100 μl Flow Cytometry Staining Buffer (eBioscience). Two microliter of CD133 (STEM CELL Technologies Inc, Canada) were added and incubated for 20 min in dark. Next, the cells were washed by Flow Cytometry Staining Buffer and prepare to be detected. The CD133-positive subpopulation was detected by FACS (BD Accuri C5, USA).
For the ALDH assay, cells were identified using the ALDEFLUOR reagent kit (STEMCELL). Cells were suspended in ALDEFLUOR assay buffer at a concentration of 1 × 105 cells/ml and divided into two tubes labeled “control” and “test”. Diethylaminobenzaldehyde (DEAB), a specific ALDH inhibitor, was added to the control tube to control for background fluorescence. Activated ALDEFLUOR reagent was added to tubes. The tubes were incubated for 30 min at 37 °C, and the tubes were then centrifuged for 5 min at 250 × g. Cell pellets were resuspended in ALDEFLUOR assay buffer and stored on ice. The ALDH1-positive subpopulation was detected by FACS (BD Accuri C5, USA).
For the ALDH assay, cells were identified using the ALDEFLUOR reagent kit (STEMCELL). Cells were suspended in ALDEFLUOR assay buffer at a concentration of 1 × 105 cells/ml and divided into two tubes labeled “control” and “test”. Diethylaminobenzaldehyde (DEAB), a specific ALDH inhibitor, was added to the control tube to control for background fluorescence. Activated ALDEFLUOR reagent was added to tubes. The tubes were incubated for 30 min at 37 °C, and the tubes were then centrifuged for 5 min at 250 × g. Cell pellets were resuspended in ALDEFLUOR assay buffer and stored on ice. The ALDH1-positive subpopulation was detected by FACS (BD Accuri C5, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!