Abi 7300 real time pcr instrument
The ABI 7300 real-time PCR instrument is a laboratory instrument designed for performing quantitative real-time polymerase chain reaction (qPCR) assays. It is capable of detecting and quantifying specific DNA sequences in real-time during the PCR amplification process.
Lab products found in correlation
43 protocols using abi 7300 real time pcr instrument
Quantitative Analysis of RNF5 Expression
qRT-PCR Quantification of Gene Expression
Quantitative RT-PCR Analysis of SH3GL2, MMP2 Expression
SH3GL2‐F: 5‐AAGCAGTTCCATAAAGCCACT‐3,
SH3GL2‐R: 5‐TCCTGGCCACGGATTTTTGA‐3;
MMP2‐F: 5‐CAGGATCATTGGCTACACACC‐3,
MMP2‐R: 5‐CCATACTTCACACGGACCACT‐3;
GAPDH‐F: TGGAGTCCACTGGCGTCTTC,
GAPDH‐R: CATTGCTGATGATCTTGAGGCT.
Quantitative miRNA Expression Analysis
Quantification of Cholinergic Markers in Rat Cortex
The ΔΔCT method of relative quantification was used to determine the fold change in expression. This was done by first normalizing the resulting threshold cycle (CT) values of the target mRNAs to the CT values of the internal control β-actin in the same samples (ΔCT = CT Target − CT β-actin). It was further normalized with the control (ΔΔCT=ΔCT − CT Control). The fold change in expression was then obtained (2-ΔΔCT).
Quantifying Nmnat and Sirt1 Expression
Quantitative Analysis of Gene Expression
Quantifying Adipogenesis and Myogenesis Genes
Quantitative Real-Time PCR for USP1 Expression
Real-time PCR for Dehalococcoides Quantification
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!