qRT-PCR analysis was performed on cDNA synthesized from total RNA using the Superscript III cDNA synthesis system (Life Technologies). cDNA samples were then amplified using the SYBR green qPCR assay kit (Applied Biosystems) and the ABI Prism 7300 Sequence Detector (Applied Biosystems)(32 (link)). qPCR primers used for detection of CRB3, HUGL2, PATJ, CDC42, CTGF, CYR61, MYC, MUC1 and GAPDH are listed in Supplemental Table S1 . Statistical significance was determined by the Student’s t-test.
Superscript 3 cdna synthesis system
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom, United States
The Superscript III cDNA synthesis system is a laboratory equipment product designed for the synthesis of complementary DNA (cDNA) from RNA templates. It provides a robust and efficient method for the conversion of RNA into cDNA, which is a crucial step in various molecular biology and genomic research applications.
Automatically generated - may contain errors
Lab products found in correlation
Abi 7900 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Sybr primescript ready mix, by Takara Bio (2 mentions)
Rneasy, by Qiagen (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Abi prism 7300 sequence detector, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr assay kit, by Thermo Fisher Scientific (1 mentions)
Viral rna mini kit, by Qiagen (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Prime a gene labeling system, by Promega (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Sybr green system, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Molecular imager gel doc xr system, by Bio-Rad (1 mentions)
Rnase free dnase 1, by Promega (1 mentions)
7500 rt pcr system, by Thermo Fisher Scientific (1 mentions)
Icycler machine, by Bio-Rad (1 mentions)
Sybr green pcr supermix, by Roche (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Trizol extraction, by Thermo Fisher Scientific (1 mentions)
15 protocols using superscript 3 cdna synthesis system
1
qRT-PCR Analysis of Cell Polarity Genes
2
Improving Pestivirus A cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Initial experiments showed that priming cDNA synthesis with random primers led to a poorer yield of full-length cDNA, with clear reduction in representation of the 3′-end of the genome. In order to improve coverage of full-length genomes, two approaches were used. In the first approach, a pestivirus A genotype 1a-specific primer (B12; Table 2 ) was used to prime cDNA synthesis from the 3′-end of the viral genome, whilst in the second approach, viral RNA samples were polyadenylated using poly-A polymerase before cDNA synthesis primed by anchored oligo-dT primers. In each case, synthesis of double-stranded cDNA was done using the Superscript III cDNA synthesis system (Life Technologies), with RNAseH, Escherichia coli E. coli
The presence of double-stranded pestivirus A-specific cDNA after synthesis was assayed qualitatively by end-point PCR before and after restriction endonuclease digestion of the cDNA, using primers that amplified either conserved regions of the virus (all samples) or the entire NADL genome as a set of overlapping amplicons. Restriction enzyme treatment of cDNA clearly reduced the yield of PCR products (not shown).
The presence of double-stranded pestivirus A-specific cDNA after synthesis was assayed qualitatively by end-point PCR before and after restriction endonuclease digestion of the cDNA, using primers that amplified either conserved regions of the virus (all samples) or the entire NADL genome as a set of overlapping amplicons. Restriction enzyme treatment of cDNA clearly reduced the yield of PCR products (not shown).
3
Optimizing Full-Length cDNA Synthesis for Viral Genome Coverage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Initial experiments showed that priming cDNA synthesis with random primers led to a poorer yield of full-length cDNA, with clear reduction in representation of the 3'-end of the genome. In order to improve coverage of full-length genomes, two approaches were used. In the first approach, a Pestivirus A genotype 1a-specific primer (B12; Table 1) was used to prime cDNA synthesis from the 3'-end of the viral genome, whilst in the second approach, viral RNA samples were polyadenylated using polyA polymerase before cDNA synthesis primed by anchored oligo dT primers. In each case, synthesis of double-stranded cDNA was done using the Superscript III cDNA synthesis system (Life Technologies), with RNAseH, E. coli DNA polymerase and E. coli DNA ligase in the second strand mix.
The presence of double-stranded BVD-specific cDNA after synthesis was assayed qualitatively by end-point PCR before and after restriction endonuclease digestion of the cDNA, using primers that amplified either conserved regions of the virus (all samples) or the entire NADL genome as a set of overlapping amplicons. Restriction enzyme treatment of cDNA clearly reduced the yield of BVD PCR products (not shown).
The presence of double-stranded BVD-specific cDNA after synthesis was assayed qualitatively by end-point PCR before and after restriction endonuclease digestion of the cDNA, using primers that amplified either conserved regions of the virus (all samples) or the entire NADL genome as a set of overlapping amplicons. Restriction enzyme treatment of cDNA clearly reduced the yield of BVD PCR products (not shown).
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from WT and Bloc1s2−/− dissected cortices at E14.5 with RNeasy (Qiagen) and used to generate first-strand cDNA with the Superscript III cDNA synthesis system (Invitrogen) according to the manufacturer’s instructions. qRT-PCR analysis was performed using SYBR PrimeScript Ready Mix (Takara) in an ABI 7900 sequence detection system (Applied Biosystems). GAPDH expression was used for normalization. Total RNAs are from the dissected trunk region of zebrafish embryos. The PCR primers are listed in Supplementary file 2 .
5
Dengue Virus RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was isolated from 140 µl of collected human plasma and mosquito homogenates using a Viral RNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The isolated RNA was then used for cDNA synthesis as previously described (Yenchitsomanus et al. 1996 ) using dengue virus-specific primer DEUR (5′-GCTGTGTCACCCAGAATGGCCAT-3′) and a Superscript III cDNA synthesis system (Invitrogen, Carlsbad, CA, USA).
6
Analysis of ECD1 Gene Expression in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total leaf RNA was extracted from 7-d-old seedlings, and from 14-d-old cotyledons and true leaves using an RNeasy Plant Mini kit (Qiagen). RNA concentration was determined using thermo NanoDrop 2000. Total RNA from seedlings of the wild-type and the ECD1-RNAi-1 line was separated on 1.3% (w/v) agarose-formaldehyde gels, blotted to a nylon membrane, and subsequently hybridized with a probe labeled with 32P. The probes were prepared by PCR amplification and labeled using the Prime-a-Gene Labeling System (SGMB01-Promega-U1100).
RNA was used to generate first-strand cDNA in a 20-μl reaction using the Superscript III cDNA synthesis system (Invitrogen). The resulting cDNA samples were used as templates for RT-PCR analysis. Quantitative RT-PCR was performed using the SYBR Premix ExTaq Kit (Takara) following the manufacturer’s instructions with a Light Cycler 480 system. The expression level was normalized to that of an ACTIN control.
RNA was used to generate first-strand cDNA in a 20-μl reaction using the Superscript III cDNA synthesis system (Invitrogen). The resulting cDNA samples were used as templates for RT-PCR analysis. Quantitative RT-PCR was performed using the SYBR Premix ExTaq Kit (Takara) following the manufacturer’s instructions with a Light Cycler 480 system. The expression level was normalized to that of an ACTIN control.
7
Osteoclast RNA Isolation and qPCR
8
Quantifying Gene Expression in Liver Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Qiagen’s RNeasy Mini Kit (Qiagen, UK) was used for RNA extraction from liver tissues. After RNA normalization of all the tubes to 2 μg, reverse transcription with SuperScript III cDNA Synthesis System (Invitrogen, UK) to complementary DNA (cDNA) was carried out in a 20 μL reaction mix. Gene Runner software was used for primer design. Primers had sequences of different exons with spanning and flanking of introns to exclude the amplification of contaminating genomic DNA (gDNA). Table 3 gives the primer sequences for β-actin, Bax, and Bcl-2. Relative expression patterns of assessed genes were carried out with 1 μL synthesized cDNA (10 ng/μL) as the template in 5 μL Power Up SYBR Green PCR Master Mix and 0.75 μL of each primer using a 7500 Fast real-time PCR system (Applied Biosystems). β-Actin was selected as the housekeeping gene. Results were validated using the relative quantification (ΔΔCt) method. The genes were measured in triplicates and the mean for these runs was normalized with the mean of β-actin (Table 3 ).
9
Viral Movement Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from newly emerging leaves of mock, BSMV:00 empty vector and BSMV:ZzPDS—infiltrated test plants individually as described by Salzman et al. [13 (link)], and treated with RNase-free DNase I (Promega, USA). First-strand cDNA was synthesized using 2 μg of total RNA and a Superscript III cDNA Synthesis System (Invitrogen). RT–PCR for viral movement were carried out using BSMV γ-specific primers (BSMV GF1 and BSMV GR1; S1 Table
10
RT-PCR Analysis of Apoptosis-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was used for this analysis. Using a Qiagen RNeasy mini kit, mRNA extraction from MCF7 cells was carried out. Reverse transcription with a SuperScript III cDNA-synthesis system (Invitrogen, UK) of cDNA proceeded in a 20 μL reaction mix. Table 1 displays the primer sequences related to CASP3, CASP7, and CDK1. ACTB was used as the housekeeping gene. Relative expression was obtained with 1 μL synthesized cDNA (10 ng/μL) as the template in 5 μL PowerUp SYBR green PCR master mix and 0.75 μL of each primer utilizing an Applied Biosystems 7500 RT-PCR system. Relative quantification (ΔΔCt) was used.
Primer sequences used for mRNA expression of apoptosis-related genes using RT-PCR
| Sequence (5′–3′) | ||
|---|---|---|
| Forward primer | TTC ATT ATT CAG GCC TGC CGA GG | |
| Reverse primer | TTC TGA CAG GCC ATG TCA TCC TCA | |
| Forward primer | GGACCGAGTGCCCACTTATC | |
| Reverse primer | TCGCTTTGTCGAAGTTCTTGTT | |
| Forward primer | TGGATCTGAAGAAATACTTGGATTCTA | |
| Reverse primer | CAATCCCCTGTAGGATTTGG | |
| Forward primer | TCCGTCGCCGGTCCACACCC | |
| Reverse primer | TCACCAACTGGGACGATATG | |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!