Using TRIzol reagent, Total RNA was extracted from colon cancer cells to generate cDNA for RT-qPCR analysis. Then, the cDNA was amplificated with QuantiTect PCR Kits (Qiagen, CA, USA) by utilizing a 7500 Real-Time PCR System (Applied Biosystems, CA, USA). The primer sequences for USP36 and GADPH were described as follows: USP36, reverse: 5′-CATCGACGCCATGCAGAAAG-3′, forward: 5′-AGTAGGGGTCGTAGGTGTCC-3′; GAPDH, reverse: 5′-GAGAAGGCTGGGGCTCATTT-3′, forward: 5′-AGTGATGGCATGGACTGTGG-3′. The calculation of relative RNA expression was based on the 2−ΔΔCt method [43 (link)].
Quantitect pcr kits
Manufactured by Qiagen
Sourced in United States
The QuantiTect PCR Kits are a collection of real-time PCR reagent kits developed by Qiagen. The kits are designed to enable sensitive and reproducible gene expression analysis and quantification of DNA and RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using quantitect pcr kits
1
Quantification of USP36 Expression in Colon Cancer
2
Quantitative ChIP-qPCR Analysis of SNCA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative analysis of ChIP results was performed using ChIP-qPCR. The ChIP-qPCR was performed using QuantiTect PCR Kits (QIAGEN) as previously described (64 (link)). The ChIP input sample was used to calculate ChIP binding signal (as input %). IgG ChIP sample was used as a negative control. Each experiment was repeated at least three times. Primers used for ChIP-qPCR are listed in table S3. To analyze the RNA Pol II pause, SNCA promoter primers were used to detect the Pol II binding on the promoter region, and the SNCA Exon 2 and SNCA Exon 4 were used to detect the Pol II binding on the SNCA gene body.
3
Quantitative Analysis of Fibroblast Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolated from dermal tissues and fibroblasts using TRIzol reagent was obtained to generate complementary DNA (cDNA) for RT‐qPCR analysis. The amplification of cDNA was performed using QuantiTect PCR Kits (Qiagen) with 7500 Real‐Time PCR System (Applied Biosystems). The primer sequences used in this study were listed as followed: α‐SMA (forward: 5′‐AGCAGGCCAAGGGGCTATATAA‐3′; reverse: 5′‐TTCGTAGCTGTCTTTTTGTCCCA‐3′), Collagen I (forward: 5′‐GAACCTGGGATAGCAGGACAC‐3′; reverse: 5′‐CATAGTGGGTCCACAAAGACATC‐3′), PD‐L1 (Forward: 5′‐GGTGCCGACTACAAGCGAAT‐3′; reverse: 5′‐TAGCCCTCAGCCTGACATGTC‐3′), and β‐actin (forward: 5′‐CACCATTGGCAATGAGCGGTTC‐3′; reverse: 5′‐ AGGTCTTTGCGGATGTCCACGT‐3′). The relative expression of RNA was calculated using the 2−ΔΔCt method.19
4
Quantification of SNCA mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression level of SNCA mRNA in SNCA EnKO rats was analyzed by RT-PCR and RT-qPCR as previously described (66 (link)). In brief, brain tissue total RNA was extracted using the RNeasy Lipid Tissue Mini Kit (QIAGENE) and reverse-transcribed into cDNA using the Omniscript RT Kit. Total human SNCA cDNA transcript was amplified using primers targeting exon 2 and the 3′ untranslated region (3′UTR) of the SNCA gene (forward primer: AAGCAGCAGGAAAGACAAAA; reverse primer: ACATCTGTCAGCAGATCTCA). RT-qPCR of the human SNCA mRNA was performed using QuantiTect PCR Kits (QIAGEN) with the primers targeting exon 5 and 3′UTR of the SNCA gene (forward primer: CTGTGGATCCTGACAATGAG; reverse primer: CAAGAAACTGGGAGCAAAGA). Rat housekeeping gene actin was used as an internal control (forward primer: AGAAGGAGATTACTGCCCTG; reverse primer: CCACCAATCCACACAGAGTA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!