Log In Sign up
The largest database of trusted experimental protocols

Hifair 3 first strand cdna system

Manufactured by Yeasen
Visit Supplier
Sourced in China

The Hifair III First Strand cDNA System is a laboratory equipment designed for the synthesis of complementary DNA (cDNA) from RNA samples. It includes all the necessary reagents and components required for the reverse transcription process, which converts RNA into single-stranded cDNA.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green rt pcr master mix, by Thermo Fisher Scientific (2 mentions) Chamq universal sybr qpcr master mix, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

Hifair III (2 citations)

3 protocols using hifair 3 first strand cdna system

1

Quantifying Inflammatory Cytokine Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cultured cells or mouse heart tissues using TRIzol reagent, and 1 μg of total RNA was reverse-transcribed from RNA to cDNA using the Hifair III First Strand cDNA System (Yeasen Biotechnology Co., Ltd, China, 11141ES60). The relative expression data were gathered using the 2−△△Ct technique. Each experiment was carried out three times with biological replicates. In Table 1, the primers are illustrated.

Primers Sequences for RT-PCR

GeneForwards primer (5′ to 3′)Reverse primer (5′ to 3′)
IL-6 (mouse)GCCTTCTTGGGACTGATGCTGACAGGTCTGTTGGGAGTGG
IL-1β (mouse)GCTTCAGGCAGGCAGTATCAAAGGTCCACGGGAAAGACAC
IL-1β (rat)AGCTGTGGCAGCTACCTATGGGTCGTCATCATCCCACGAG
TNF-α (mouse)GATCGGTCCCCAAAGGGATGCCACTTGGTGGTTTGTGAGTG
TNF-α (rat)GATCGGTCCCAACAAGGAGGGCTTGGTGGTTTGCTACGAC
IL-18 (rat)CAAAAGAAACCCGCCTGTGTATAGGGTCACAGCCAGTCCT
GAPDH (mouse)TGATGGGTGTGAACCACGAGGCCCTTCCACAATGCCAAAG
GAPDH (rat)GCGAGATCCCGCTAACATCACTCGTGGTTCACACCCATCA
Li J., Teng D., Jia W., Gong L., Dong H., Wang C., Zhang L., Xu B., Wang W., Zhong L., Wang J, & Yang J. (2024). PLD2 deletion ameliorates sepsis-induced cardiomyopathy by suppressing cardiomyocyte pyroptosis via the NLRP3/caspase 1/GSDMD pathway. Inflammation Research, 73(6), 1033-1046.
+ Open protocol
+ Expand
2

Total RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The manufacturer’s (Vazyme) recommended procedure for using the TRIzol reagent to isolate total RNA was followed. According to the manufacturer’s recommendations, the RNA was reverse-transcribed using a Hifair III First Strand cDNA System (Yeasen Biotechnology). In the PCR amplification, ChamQ Universal SYBR Qpcr Master mix (Applied Biosystems, Vazyme) was used together with 1.0 ul of cDNA and SYBR Green RT-PCR Master Mix. The expression standards of each candidate gene were compared to GAPDH, the internal standard. Using the 2−△△Ct method, relative quantitative data were obtained. Each test was carried out three times. The primers are shown in Supplement 1.
Teng D., Chen H., Jia W., Ren Q., Ding X., Zhang L., Gong L., Wang H., Zhong L, & Yang J. (2023). Identification and validation of hub genes involved in foam cell formation and atherosclerosis development via bioinformatics. PeerJ, 11, e16122.
+ Open protocol
+ Expand
3

Total RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The manufacturer’s (Vazyme) recommended procedure for using the TRIzol reagent to isolate total RNA was followed. According to the manufacturer’s recommendations, the RNA was reverse-transcribed using a Hifair III First Strand cDNA System (Yeasen Biotechnology). In the PCR amplification, ChamQ Universal SYBR Qpcr Master mix (Applied Biosystems, Vazyme) was used together with 1.0 ul of cDNA and SYBR Green RT-PCR Master Mix. The expression standards of each candidate gene were compared to GAPDH, the internal standard. Using the 2−△△Ct method, relative quantitative data were obtained. Each test was carried out three times. The primers are shown in Supplement 1.
Teng D., Chen H., Jia W., Ren Q., Ding X., Zhang L., Gong L., Wang H., Zhong L, & Yang J. (2023). Identification and validation of hub genes involved in foam cell formation and atherosclerosis development via bioinformatics. PeerJ, 11, e16122.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!