Recombinant erαprotein

Manufactured by Thermo Fisher Scientific

Recombinant ERα protein is a laboratory reagent produced by Thermo Fisher Scientific. It is a recombinant form of the estrogen receptor alpha (ERα) protein, which is a member of the nuclear receptor family and functions as a transcription factor. The core function of this protein is to bind to estrogen and regulate the expression of target genes involved in a variety of cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Erα antibody, by Abcam (1 mentions)

4 protocols using recombinant erαprotein

ERα Binding Site Identification via EMSA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

EMSA was performed as detailed formerly [15 (link)] using DNA fragments containing putative ERα binding sites labeled with [³²P] dCTP by Klenow. The sequences of the two potential ERE sites, ERα 1 and 2 (ERE sequences underlined), 25kb downstream of the TLR8 gene are: ERα 1:5’-GGGTCCCCTGTGACCTGCACGTACA -3’, ERα 2: 5’- GGGGTGTGACCTGGCAATTTGTTTA -3’. ERα antibody (abcam, Cambridge, MA) and/or recombinant ERαprotein (Thermo Scientific, Rockford, IL) were incubated with DNA fragments prior to electrophoresis. Relative complex formation was determined using Image J software (NIH) and normalized to the untreated or baseline levels, both designated +1.

Young N.A., Wu L.C., Burd C.J., Friedman A.K., Kaffenberger B.H., Rajaram M.V., Schlesinger L.S., James H., Shupnik M.A, & Jarjour W.N. (2014). Estrogen modulation of endosome-associated toll-like receptor 8: an IFNα-independent mechanism of sex-bias in systemic lupus erythematosus. Clinical immunology (Orlando, Fla.), 151(1), 66-77.

+ Open protocol

+ Expand

Probing ERα-STAT1 Transcriptional Interactions

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

EMSA was performed as detailed formerly [14 (link)]. Briefly, cells were stimulated with 10 nM E2 (Sigma) for the indicated time and nuclear lysates were incubated with probes labeled with [32P] dCTP by the Klenow fragment of DNA polymerase. Probes corresponding to the putative ERE site proximal to the STAT1genetic locus included: 5′-GGGAGAATCTAGGTCAAGGTCCTTC-3′ and 5′-GAAGGACCTTGACCTAGATTCT-3′. Additionally, recombinant ERα protein (Thermo Scientific) was incubated with these DNA fragments to confirm the specificity prior to gel electrophoresis. Probes designed to interrogate a previously characterized STAT1 binding region downstream of the TLR8 genetic locus [18 (link)] included: 5′-GGGCTTTATTCTCTGAAACACCCACT and 5′-AGTGGGTGTTTCAGAGAATAAAG.

Young N.A., Valiente G.R., Hampton J.M., Wu L.C., Burd C.J., Willis W.L., Bruss M., Steigelman H., Gotsatsenko M., Amici S.A., Severin M., Claverie L.M., Guerau-de-Arellano M., Lovett-Racke A., Ardoin S, & Jarjour W.N. (2016). Estrogen-regulated STAT1 activation promotes TLR8 expression to facilitate signaling via microRNA-21 in systemic lupus erythematosus. Clinical immunology (Orlando, Fla.), 176, 12-22.

+ Open protocol

+ Expand

Estrogen Receptor Binding Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-7:WS8 and MCF-7:5C cells were grown in 20-30 15-cm dishes, and nuclear extracts (NEs) were made. The 4x estrogen response element (ERE) DNA pulldown assays were performed; by first immobilizing four copies of the Xenopus Vitellogennin ERE sequences onto Dynabeads M280 streptavidin as described previously (39 (link)). One mg of NE from MCF-7:WS8 or MCF-7:5C cells, and 0.5 μg recombinant ERα protein (Invitrogen), were added to 4xERE-beads, with either vehicle controls (ethanol or DMSO), or E₂ (100 nM), BMI-135 (1 μM), TTC-352 (1 μM), E₄ (1 μM), BPTPE (1 μM), and endoxifen (1 μM), for a 1.5 hour incubation at 4°C. After performing three washes, the final coregulator-ERα-ERE DNA complexes were eluted from the beads in 30 μl 2x SDS-sample buffer for mass spectrometry as described previously (39 (link)). The detailed methodology is presented in supplementary materials.

Abderrahman B., Maximov P.Y., Curpan R.F., Fanning S.W., Hanspal J.S., Fan P., Foulds C.E., Chen Y., Malovannaya A., Jain A., Xiong R., Greene G.L., Tonetti D.A., Thatcher G.R, & Jordan V.C. (2020). Rapid Induction of the Unfolded Protein Response and Apoptosis by Estrogen Mimic TTC-352 for the Treatment of Endocrine-Resistant Breast Cancer. Molecular cancer therapeutics, 20(1), 11-25.

+ Open protocol

+ Expand

Extraction and Characterization of ER-Cofactor Complexes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-7:5C cells were grown in 25–15-cm Petri dishes in media containing charcoal stripped fetal bovine serum as indicated above. Nuclear extracts were then made and protein concentration determined as previously described for MCF-7 cells (Foulds et al., 2013 (link)). DNA pulldown assays used a doubly 5′-biotinylated 921 bp template containing four copies of the Xenopus vitellogenin ERE sequence immobilized onto Dynabeads M280 streptavidin as previously described (Foulds et al., 2013 (link)). One milligram of MCF7:5C nuclear extract and 0.5 μg recombinant ERα protein (Invitrogen) were added to 4×ERE-beads with either ethanol as vehicle control, 100 nM E₂ or 1 μM of endoxifen, Z2OHTPE, 3OHTPE, or BPTPE for a 1.5-hour incubation at 4°C. Three washes were performed as previously described (Foulds et al., 2013 (link)), and the final coregulator-ERα-ERE DNA complexes were eluted from the beads in 30 μl 2× SDS sample buffer for mass spectrometry.

Maximov P.Y., Abderrahman B., Hawsawi Y.M., Chen Y., Foulds C.E., Jain A., Malovannaya A., Fan P., Curpan R.F., Han R., Fanning S.W., Broom B.M., Quintana Rincon D.M., Greenland J.A., Greene G.L, & Jordan V.C. (2020). The Structure-Function Relationship of Angular Estrogens and Estrogen Receptor Alpha to Initiate Estrogen-Induced Apoptosis in Breast Cancer Cells. Molecular Pharmacology, 98(1), 24-37.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!