Duolink in situ pla probe anti mouse minus

Cells were plated on glass coverslips and fixed with 4% paraformaldehyde in PBS for 20 min at room temperature. When indicated, cells were incubated with EdU (5-ethynyl-2′-deoxyuridine). PFA-fixed cells were permeabilized with 0.5% Triton X-100 in PBS for 20 min. EdU was coupled with Alexa Fluor 555 or biotin–TEG azide using click chemistry. Primary antibodies against SMC1 (A300-055A; Bethyl), SMC3 (A300-060A; Bethyl), MCM5 (17967; Abcam), PCNA (P8825; Sigma-Aldrich), and biotin (A150-109A; Bethyl or 200-002-211; Jackson ImmunoResearch) were incubated overnight. Probes from Duolink In Situ PLA Probe Anti-Rabbit PLUS (DUO92002; Sigma-Aldrich) and Duolink In Situ PLA Probe Anti-Mouse MINUS (DUO92004; Sigma-Aldrich) were incubated with coverslip for 60 min at 37°C. For ligation (30 min at 37°C) and amplification (100 min at 37°C), Duolink In Situ Detection Reagents Green (DUO92014; Sigma-Aldrich) was used. The cells were mounted on glass slides with Duolink In Situ Mounting Medium with DAPI (DUO82040; Sigma-Aldrich). Cells were analyzed by fluorescence microscopy, and quantification of PLA signal was performed using CellProfiler software (Carpenter et al, 2006 (link)).

The proximity ligation assay (PLA) (Söderberg et al, 2006 (link)) was performed using the Duolink^® PLA kit (Sigma Aldrich), according to the manufacturer’s protocol. Briefly, HEK293 cells expressing FLAG- and HA-tagged proteins were fixed for 10 min in 4% paraformaldehyde, permeabilized for 20 min in PBS containing 0.5% Triton X-100 and 3% BSA, and incubated for 18–24 h at 4˚C with the anti-FLAG rabbit polyclonal (Sigma-Aldrich) and anti-HA mouse monoclonal (Covance) antibodies. Cells were then incubated for 1 h at 37 ˚C in a humidified chamber with the PLA probes: Duolink^® In Situ PLA^® Probe Anti-Mouse MINUS (Sigma Aldrich) and Duolink^® In Situ PLA^® Probe Anti-Rabbit PLUS (Sigma Aldrich). Using Duolink^® In Situ Detection Reagents Orange (Sigma Aldrich), ligation reaction was performed for 30 min at 37 ˚C, followed by amplification for 100 min at 37 ˚C. For visualization of the primary antibodies, cells were incubated for 45 min at 25 ˚C with Alexa Fluor 488-labeled goat anti-rabbit (Thermo Fisher Scientific) and Alexa Fluor 647-labeled goat anti-mouse IgG antibodies (Thermo Fisher Scientific).

Cells were fixed with 4% paraformaldehyde in PBS 1X for 20 min and permeabilized with 0.4% Triton X-100, 0.05% CHAPS for 5 min at room temperature. A quantity of 50 ng of EBNA1-digoxigenin mRNA probe (5′ CTTTCCAAACCACCCTCCTTTTTTGCGCCTGCCTCCATCAAAAA 3′) or control sense probe was denaturated 5 min at 80 °C and the hybridization reaction was carried out overnight at 37 °C in 40 μl hybridization buffer (10% formamide; 2X SSC, 0.2 mg ml^–1E. coli tRNAs, 0.2 mg ml^–1 sheared salmon sperm DNA and 2 mg ml^–1 BSA. A blocking solution of 3% BSA 0.1% saponine in 1X PBS was added for 30 min followed by 2 h incubation at room temperature with the primary antibodies (anti-digoxigenin 1/200 -Sigma- and anti-NCL 1/1000 -Abcam-) diluted in PBS 1X, 0.3% BSA, 0.1% saponine. The PLA was carried out using the Duolink PLA in situ kit, PLA probe anti-rabbit plus, the Duolink in situ PLA probe anti-mouse MINUS and the in situ detection reagent FarRed (all from Sigma) following the manufacturer’s protocol. PLA results were visualized using a Zeiss LSM780 confocal microscope. All the PLA experiments were performed at least three times independently and, each time, PLA dots were counted in 50–100 cells. For each PLA experiment, the following controls were used: w/o mRNA probe, w/o antibodies and with the control sense probe.

All antibodies used in this study were validated by conventional immunoblotting (see Figs S1 and S5). See Table S1 for antibody source and dilution used for detection in the NanoPro1000 with and without RCA/PLA and by immunoblotting. Recombinant human VEGFA (293-VE-010) was purchased from R&D Systems.
Horseradish peroxidase (HRP) conjugated anti-mouse and anti-rabbit antibodies were from ProteinSimple (#040-655, #040-656). The following secondary antibody-DNA conjugates were provided by Olink for Duolink In Situ PLA (the reagents are now available from Sigma Aldrich): Probe Anti-Mouse PLUS (Affinity Purified Donkey Anti-Mouse IgG, H+L; DUO92001), Duolink In Situ PLA Probe Anti-Rabbit PLUS (Affinity Purified Donkey Anti-Rabbit IgG, H+L; DUO92002), Duolink In Situ PLA Probe Anti-Goat PLUS (Affinity Purified Donkey Anti-Goat IgG, H+L; DUO92003), Duolink In Situ PLA Probe Anti-Mouse MINUS (Affinity Purified Donkey Anti-Mouse IgG, H+L; DUO92004), Duolink In Situ PLA Probe Anti-Rabbit MINUS (Affinity Purified Donkey anti-Rabbit IgG, H+L; DUO92005), Duolink In Situ PLA Probe Anti-Goat MINUS (Affinity Purified Donkey Anti-Goat IgG, H+L; DUO92006).

PLA was carried out using the Duolink In Situ PLA Detection kit (catalog no.: #DUO92008, Sigma–Aldrich), which includes the Duolink In Situ PLA Probe anti-rabbit PLUS (#DUO92002; Sigma–Aldrich) and Duolink In Situ PLA Probe anti-mouse MINUS (#DUO92004; Sigma–Aldrich). Briefly, cells were settled on glass coverslips and fix with methanol (−20 °C). Fixed cells were incubated in Duolink blocking solution in a humidity chamber for 60 min at 37 °C and incubated with primary antibodies for 1 h. Cells on the glass coverslips were washed two times with 1× buffer A at RT and then probed with PLUS and MINUS PLA probes for 1 h at 37 °C in a humidity chamber. Cells on the glass coverslips were washed two times with 1× buffer A at RT, incubated with ligation solution for 30 min at 37 °C, and then incubated with the amplification solution in a humidity chamber for 100 min at 37 °C. Finally, cells on the glass coverslips were washed two times with 1× buffer B and one time with 0.01× buffer B, mounted on Duolink In Situ Mounting Medium containing 4′,6-diamidino-2-phenylindole, and examined under a fluorescence microscope.

HeLa cells were cultured on glass slides and fixed with 2% PFA for 20 min. The staining of the PLA was performed following the manufacturer’s instructions with Duolink™ In Situ Detection Reagent Orange, Duolink™ In Situ PLA Probe Anti-Rabbit PLUS, Duolink™ In Situ PLA Probe Anti-Mouse MINUS, and Duolink™ In Situ Mounting Medium with DAPI (Sigma-Aldrich/Merck, St. Louis, MO, USA). As primary antibodies, rabbit-anti-human REV3L (Lifespan Biosciences, Seattle, WA, USA, LS-C368491), mouse-anti-human EndoG (Santa Cruz Biotechnology, Dallas, TX, USA, sc-365359), mouse-anti-human DNA POLγ (Santa Cruz Biotechnology, Dallas, TX, USA, sc-3906349), rabbit-anti-human DNA POLγ (Cell Signaling Techonolgy Inc., Danvers, MA, USA, 13609S) mouse-anti-human TLR4 (Santa Cruz Biotechnology, Dallas, TX, USA, sc-293072), and mouse-anti-human mtTFA (Santa Cruz Biotechnology, Dallas, TX, USA, sc-166965) were used. Images were taken with a Keyence BZ-9000 microscope (Keyence, Neu-Isenburg, Germany) and foci were counted manually.