Verikine hs human ifn beta serum elisa kit

IFN-β detection was performed with the VeriKine-HS Human IFN Beta Serum ELISA Kit (PBL Assay Science) according to the manufacturer’s instructions. To detect spontaneous IFN-β production, 4 × 10⁵ cells were seeded in six-well culture plates on day 1. On day 2, the culture media was replaced with 1.5 mL of fresh media for each well. On day 3, 200 μL of conditioned media from each well was collected and spun to pellet cells. Fifty microliters of conditioned media was assayed in duplicate for each sample. Fresh RPMI media was used as the diluent for all standards and blanks. All concentrations of IFN-β were calculated according to the standard curve generated in each experiment. For exogenous IFN-I treatment experiments, 2 × 10⁵ cells were seeded in six-well culture plates on day 1. On day 2, the culture media was replaced with media supplemented with recombinant IFN-α or IFN-β (both at 10 ng/ml). On day 3, the culture media was replaced with 1.5 mL fresh media for each well. On day 4, the enzyme-linked immunosorbent assay was performed on the conditioned media as described above.

Culture supernatants were concentrated using Amicon Ultra Centrifugal Filters 10 K  (Merck Millipore, Darmstadt, Germany). IFN-β present in the culture media of myotubes exposed to hypoxia (1% of O₂ and CoCl₂-treated myotubes) was detected with VeriKine-HS Human IFN Beta Serum ELISA kit (PBL Assay Science, Piscataway Township, NJ), following manufacturer’s instructions. All samples were analyzed by triplicate. The limit of detection was 1.2 pg/ml. IFN-α in culture media was detected with VeriKine-HS Human IFN alpha ELISA kit (PBL Assay Science), the limit of detection was 12.5 pg/ml.

Spontaneous IFN-β production was detected by the VeriKine-HS Human IFN Beta Serum ELISA Kit (PBL Assay Science, 41515–1) according to the manufacturer’s instructions. A172 cells were seeded at a density of 70,000 cells per well in a 24-well plate. Next day, the cells were transfected with siRNAs by using the Lipofectamine RNAiMAX (Invitrogen). The cells were treated with 1,000 U/ml human IFN-α, 48 h after siRNA transfection. The cells were gently washed once with medium, then 350 μl fresh warm medium was replaced in the wells, 30 h after IFN-α stimulation. After 72 h of incubation, 50 μl of the supernatant was collected and the concentration of IFN-β was measured by the kit.

UM-Chor1-Cas9 cells were seeded at a density of 300,000 cells/well in six-well collagen I-coated plates. Cells were transduced with lentivirus as described in the Methods section corresponding to CRISPR-Cas9 screening validation. Following selection for infected cells with media containing 2 µg/mL puromycin, selective growth media was replaced with standard growth media. At 1, 2, and 3 days post-media-change, an aliquot of conditioned media was harvested from cells and centrifuged to remove any residual cells. The supernatant was assayed for IFN-β levels using the VeriKine-HS™ Human IFN Beta Serum ELISA Kit (PBL Assay Science), following “Protocol A” provided by the manufacturer.
Absorbance values of the ELISA were measured at 450 nm with a SpectraMax M5 microplate reader (Molecular Devices), using SoftMax Pro software (version 5.4; Molecular Devices). To calculate IFN-β titers, optical densities (ODs) for media alone samples were first subtracted from the standard and sample ODs to eliminate background, and the IFN-β concentration in the samples was determined from a standard curve, fit with a sigmoidal, four-parameter logistic equation (GraphPad Prism 9). Concentrations too low to be determined by the standard curve were set to zero. Statistical analyses were performed with GraphPad Prism 9. The experiment was performed three times.

A549 cells were transfected with 3p-hpRNA 5’ triphosphate hairpin RNA (VhpRNA, 5’pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC- 3’), a 89-mer synthesized from a sequence of influenza A H1N1 virus (Invivogen, 3p-hpRNA) using Lyovec reagent for transfection following the manufacturer’s protocol (Invivogen, lyec-12). After 3h, 6h and 24h cells were fixed in PFA 4% for immunofluorescence assays and supernatants were harvested for interferon beta (IFNβ) quantification. IFNβ measurement was performed using verikine-HS human IFN beta serum ELISA Kit (PBL assay science, 41415–1) following manufacturer’s instructions.