Faststart dna masterplus sybr green 1

Total RNA was purified using a MagNA Pure compact RNA isolation kit (Roche Diagnostics, Burgess Hill, UK) according to manufacturer instructions. cDNA was synthesized using Transcriptor Universal cDNA master mix (Roche Diagnostics), and qRT-PCR was performed using FastStart DNA Master^PLUS SYBR Green I (Roche Diagnostics) on a Light Cycler 2.0 instrument (Roche Diagnostics) under conditions recommended by the manufacturer. The forward and reverse primer sequences were as follows: mouse Ccl2, 5′-AGCAAGATGATCCCAATGAGT-3′ and 5′-GAGCTTGGTGACAAAAACTACAG-3′; mouse Cxcl10, 5′-CCCACGTGTTGAGATCATTG-3′ and 5′-CAGTTAAGGAGCCCTTTTAGACC-3′; mouse Ccr2, 5′-CAAAATGGATGCCTTAGCACTG-3′ and 5′-CCAGGTTTTCATGTTTGGCTATTC-3′; mouse Cxcr3, 5′-CCAAGCCATGTACCTTGAGGTTAG-3′ and 5′-GCTCTCGTTTTCCCCATAATCGTAG-3′; mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh), 5′-CAGAACATCATCCCTGCATC-3′ and 5′-CTGCTTCACCACCTTCTTGA-3′. mRNA levels were normalized to that of Gapdh.

Messenger RNA was extracted using the High Pure RNA isolation kit (Roche Diagnostics), and cDNA synthesis was performed using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics). PCR was performed using specific forward and reverse primers designed for: TH (5′-CGGGCTTCTCGGACCAGGTGTA-3′ and 5′-CTCCTCGGCGGTGTACTCCACA-3′), Nurr1 (5′-CTGCAAAAGGAGACAATATAGACCA-3′ and 5′-ATCGTAGACCCCAGTCACATAA-3′), Dopamine transporter (DAT; 5′-TTCCTCAACTCCCAGTGTGC-3′ and 5′-AGGATGAGCTCCACCTCCTT-3′), Dopamine beta-hydroxylase (DBH; 5′-CTTCCTGGTCATCCTGGTGG-3′ and 5′-TCCAGGGGGATGTGATAGGG-3′) and ribosomal protein L22 (5’-CACGAAGGAGGAGTGACTGG-3’ and 5’-TGTGGCACACCACTGACATT-3’). Fast Start DNA Master Plus SYBR Green I (Roche Diagnostics) was applied using the following protocol: denaturation program, 95°C for 10 min followed by 45 cycles of 95°C for 10 sec, 60°C for 10 sec and 72°C for 10 sec.

The total RNA extractions from the mouse livers were performed using TRIzol reagent (Invitrogen, Carlsbad, CA), and cDNA was synthesized from the total RNA by reverse transcription using Transcriptor Universal cDNA Master (Roche, Indianapolis, IN). Real-time PCR to monitor the mRNA expression was carried out using Fast Start DNA Master PLUS SYBR Green I (Roche), and measured by a Light Cycler (Reche). Each procedure was performed in accordance with the manufacturer’s protocol. The following specific primer sets for Hydroxymethylglutaryl-CoA (HMG-CoA) reductase (HMGR), HMG-CoA synthase (HMGS), and cholesterol 7 alpha-hydroxylase 1 (CYP7A1) were used in this study: HMGR (sense primer: 5’- TTGCTACTTCTGCGAAGGCA -3’, anti-sense primer: 5’- TCCGTGAGGGAATTCAAGGC -3’); HMGS (sense primer: 5’- AAGCTCAGAGAGGACACCCAT -3’, anti-sense primer: 5’- CGAGCGTAAGTTCTTCTGTGC -3’); and CYP7A1 (sense primer: 5’- TTGCTACTTCTGCGAAGGCA -3’, anti-sense primer: 5’- TCCGTGAGGGAATTCAAGGC -3’).

Cells were transfected with the following siRNAs corresponding to MMP2, MMP7, MMP9, and MMP14. Silencer^® Select siMMP2 (Cat. #4427038, Assay ID: s8852), siMMP7 (Cat. #4427037, Assay ID: s8858), siMMP14 (Cat. #4427038, Assay ID: s8878), and MMP9 siRNA (Cat. # sc-29400) were purchased from Thermo Fisher Scientific and Santa Cruz Biotechnology, Inc., respectively. Cells were transfected with 5 nM siRNA(MMP2, MMP7, and MMP14) or 25 nM (MMP9) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol and cultured for 2 days. Each siRNA-induced gene knockdown was assessed by real-time PCR.
Total RNA was isolated from the cells using the Maxwell^® 16 LEV simplyRNA purification kit (Promega). For reverse transcription, 1 μg of total RNA was treated with Moloney murine leukemia virus reverse transcriptase (Invitrogen) using random primers [non-adeoxyribonucleotide mixture; pd(N)₉] (Takara Bio Inc., Shiga, Japan). Quantitative real-time PCR was performed using FastStart DNA Master Plus SYBR Green I in LightCycler^® 96 (Roche Applied Science) according to the manufacturer’s protocols. The housekeeping gene G3PDH was used as an internal control for quantification. The primers used for real-time PCR are mentioned in Supplementary Table 2.