Scramble shrna

The method of transfecting short-hairpin RNA (shRNA) was described as previously reported [22 (link)]. For transfection of shRNA, lentiviral particles shRNA encoding targeting genes, or scramble shRNA (Sigma, St. Louis, MO, USA) were used. Puromycin (5 μg/mL) was used to select transfected cells after transfected with indicated shRNA for three days. For transfection of plasmid, empty vector or ZEB1 plasmid was used (Shanghai Fubio Co., LTD, Shanghai, China). As for cells transfection, ExFect transfection reagent (Vazyme, Nanjing, China) was used according to the manufacturer’s instruction. The expression levels of indicated proteins were detected to verify transfected cells.

Lentiviral shRNAs in vector backbone pLKO.1(Moffat et al, 2006 (link)) were Scramble shRNA (addgene #1864; DNA barcode CCTAAGGTTAAGTCGCCCTCG),
Cry2-targeting shRNA (Sigma-Aldrich, clone TRCN0000194121; DNA barcode GCTCAACATTGAACGAATGAA).
Lentiviral particles were produced in HEK293T cells using envelope vector pMD2.G and packaging
plasmid psPAX2 as previously described (Salmon & Trono, 2007 ). NIH3T3-Rev-VNP1 cells were transduced with viral particle-containing supernatants
according to standard procedures, and transduced cells were selected on 5 mg/ml puromycin.