Total RNA of all samples was extracted using EZ-10 DNAaway RNA Mini-Preps Kit (Sangon Biotech, Shanghai, China) and the quality of total RNAs was evaluated using an Agilent 2100 Bio-analyzer (SA Pathology, Adelaide, SA, Australia). High-quality RNAs (RIN > 8.0) were used for the following cDNA synthesis and library construction. For Illumina RNA sequencing, 1.0 μg RNA per sample was used for cDNA synthesis with the NEBNext® Ultra™ II RNA Library Prep Kit for Illumina (NEB, USA) and sent to Biomarker Technologies Corporation (Beijing, China) for Illumina sequencing. For SMRT sequencing, equal amount of the total RNA of all samples were pooled together as the template for cDNA synthesis with the SMARTer PCR cDNA Synthesis Kit (Clontech, USA) in Biomarker Technologies Corporation (Beijing, China).
Ez 10 dnaaway rna mini preps kit
Manufactured by Sangon
Sourced in China
The EZ-10 DNAaway RNA Mini-Preps Kit is a laboratory product designed for the isolation and purification of RNA from various biological samples. The kit provides a simple and efficient method for extracting high-quality RNA, which can be used for subsequent applications in molecular biology and research.
Automatically generated - may contain errors
Lab products found in correlation
Hifair 3 1st strand cdna synthesis supermix, by Yeasen (3 mentions)
Quantstudio 3, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Yeasen (3 mentions)
Cfx96 real time system, by Bio-Rad (3 mentions)
Smarter pcr cdna synthesis kit, by Takara Bio (2 mentions)
Taq pcr master mix, by GeneCopoeia (2 mentions)
Blazetaq sybr green qpcr mix 2, by GeneCopoeia (2 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Hiscript 3 rt supermix for qpcr kit, by Vazyme (1 mentions)
Hifair 2 1st strand cdna synthesis supermix, by Yeasen (1 mentions)
Hieff qpcr sybr green master mix, by Yeasen (1 mentions)
Sybr green pcr kit, by Toyobo (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (1 mentions)
Hifair 2 1st strand cdna synthesis supermix for qpcr gdna digester plus, by Yeasen (1 mentions)
Hifair 1st strand cdna synthesis super mix for qpcr gdna digester plus, by Yeasen (1 mentions)
12 protocols using ez 10 dnaaway rna mini preps kit
1
RNA Extraction and Sequencing Protocol
2
Quantitative Real-Time PCR Analysis of LPS-Induced Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Raw264.7 cells were cultured in DMEM media (5% CSS) and then cultured in 6‐well plates (1 × 106 cells per well). After overnight incubation, the media was removed and the cells were treated with 20 ng mL−1 LPS and 10 µm indicated compounds. After 18 h incubation, the total RNA was extracted using the EZ‐10 DNAaway RNA Mini‐Preps Kit according to the manufacturer's instructions (Sangon Biotech, Shanghai, China). Hifair III 1st Strand cDNA Synthesis SuperMix (YEASEN, Shanghai, China) was used to generate cDNA. Quantitative real‐time polymerase chain reactions were performed using the SYBR Green PCR Master Mix (YEASEN, Shanghai, China) kit and 0.4 µm indicated primers. Analysis of mRNA expression was performed using the Applied Biosystems QuantStudio 3. GAPDH was used as an internal control and the relative mRNA levels were analyzed by the 2−∆∆Ct method. Primers used for the Q‐RT PCR analyses are following:
COX‐2 F: 5′‐TTCAAAAGAAGTGCTGGAAAAGGT‐3′
COX‐2 R: 5′‐GATCATCTCTACCTGAGTGTCTTT‐3′
GILZ F: 5′‐GCTGCACAATTTCTCCACCT‐3′
GILZ R: 5′‐GCTCACGAATCTGCTCCTTT‐3′
GAPDH F: 5′‐AGGCCGGTGCTGAGTATGTC‐3′
GAPDH R: 5′‐GCAGTTGGTGGTGCAGGATG‐3′
COX‐2 F: 5′‐TTCAAAAGAAGTGCTGGAAAAGGT‐3′
COX‐2 R: 5′‐GATCATCTCTACCTGAGTGTCTTT‐3′
GILZ F: 5′‐GCTGCACAATTTCTCCACCT‐3′
GILZ R: 5′‐GCTCACGAATCTGCTCCTTT‐3′
GAPDH F: 5′‐AGGCCGGTGCTGAGTATGTC‐3′
GAPDH R: 5′‐GCAGTTGGTGGTGCAGGATG‐3′
3
Activin B Regulates ADSC Transcriptome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ADSCs transduced with or without Cdc42N17 were seeded in 60-mm plastic culture plates. After 12-h serum-free starve, they were divided into four groups according to different processing methods with H-DMEM (ADSCs, Cdc42N17) or H-DMEM with 10 ng/ml activin B (Act B+ADSCs and Act B+Cdc42N17) and incubated for another 24 h. Total RNA of those cells was extracted, and genomic DNA was simultaneously eliminated using EZ-10 DNAaway RNA Mini-Preps Kit (Cat# B618133, Sangon Biotech, China) according to the manufacturer’s instructions. The quality and purity of the resulting RNA were checked using the NanoDrop™ spectrophotometer; only high-quality RNA sample (OD260/280 = 1.8–2.2, OD260/230 ≥ 2.0) could be used for sequencing and qPCR analysis.
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the EZ-10 DNAaway RNA Mini-Preps Kit (#B618133, Sangon Biotech). 1 ug total RNA was reverse transcribed using the HiScript III RT SuperMix for qPCR kit (#R323–01, Vazyme) and the resulting cDNA was diluted 20 times. RNA expression was quantified using the ChamQ universal SYBR qPCR master mix (#Q711–02, Vazyme) on the Light Cycler 480 (Roche). GAPDH, a stable housekeeping gene, was used as a reference for normalizing gene expression levels in the samples. Each sample was measured in triplicate to ensure the accuracy and reliability of the data. Relative gene expression was calculated using the ΔΔCT (ΔCT [sample] – ΔCT [control average]) method. The sequences of all oligonucleotides used in these procedures are provided in Supplementary Table 2 .
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1 × 106 RAW264.7 cells or 5 × 105 A549 cells were seeded in 12 well plates and cultured in 3% CSS DMEM media. After 24 h, the RAW264.7 cells were stimulated with 20 ng/mL LPS and 10 μM tested compounds. A549 cells were stimulated with 1 ng/mL PMA and 10 μM tested compounds. Eighteen hours later, total RNA was isolated from cells using the EZ-10 DNAaway RNA Mini-Preps Kit (Sangon Biotech, China) and cDNA was generated using the Hifair® III 1st Strand cDNA Synthesis SuperMix (YEASEN, China). Diluted cDNA was mixed with the forward primer, reverse primer, SYBR Green PCR Master Mix (YEASEN, China), and RNase-free water. Analysis of mRNA expression was carried out using the Applied Biosystems QuantStudio 3. The threshold cycles (Ct) for the control (GAPDH) and gene of interest were determined. All the samples were normalized to the level of GAPDH and the relative mRNA levels were calculated by the 2−∆∆Ct method. All primers are listed in Supplementary Table S2 .
6
qPCR Analysis of Cellular RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To extract total RNA from the cells, we used the EZ-10 DNAaway RNA Mini-Preps Kit (no. B618133, Sangon Biotech, Shanghai, China) and performed reverse transcription using the Hifair® Ⅱ 1st Strand cDNA Synthesis SuperMix (11120ES60, YEASEN, Shanghai, China) following the manufacturer’s instructions. For qPCR, we utilized Hieff® qPCR SYBR Green Master Mix (11201ES03, YEASEN, China) and performed the analysis on a CFX96 Real-Time System (Bio-Rad). The sequence for qPCR primers can be found in Table S1 . To determine the relative expression of threshold cycle (CT) value, we analyzed the qPCR results using the 2−ΔΔCt method.
7
Quantitative RT-PCR Analysis of Bacterial Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using EZ-10 DNAaway RNA Mini-Preps Kit (Sangon, China). cDNAs were then reverse-transcribed with ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Japan). Quantitative PCR was preformed using a SYBR Green PCR Kit (Toyobo) and conducted on a CFX-96 Real-Time PCR system (Bio-Rad, USA). Primer pairs q-RT-prxA-F/q-RT-prxA-R, q-RT-gsdA-F/q-RT-gsdA-R, q-RT-gndA-F/q-RT-gndA-R, q-RT-napA-F/q-RT-napA-R, and q-RT-actA-F/q-RT-actA-R (Additional file 1 : Table S2) were designed to amplify prxA, gsdA, gndA, napA, and actA, respectively. Relative mRNA levels were normalized to reference gene actA.
8
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After cell transfection and cultivation for 48 h, total RNA was extracted using an EZ-10 DNAaway RNA Mini-Preps kit (Cat# B618583-0100, Sangon Biotech, China) containing spin column, tubes, DW/RPE solutions, RNase-free water, and lysis buffer. Briefly, 300 µL lysis buffer was used to lysate cells followed by collecting into a spin column. Then, 150 µL ethanol was added and transferred to a 2 mL RNase-free collection tube for centrifuging at 12 000 × g, for 2 min at room temperature. The filtrate was discarded and added 350 µL DW solution, followed by centrifuging at 12 000 × g for 1 min at room temperature. Subsequently, the filtrate was discarded again, and 500 µL RPE Solution was added and centrifuged at 12 000 × g for 1 min at room temperature. Subsequently, the column was recentrifuged and then kept until the ethanol evaporated completely. The sample was dissolved in 30 µL RNase-free water and purity was detected using a NanoDrop one-trace UV Vis spectrophotometer (Thermo Scientific, USA). Subsequently, the sample was reverse transcribed to cDNA using a CWBIO’s kit (Cat# CW2569, CWBIO, China; Reaction conditions: 42 °C for 15 min; 85 °C for 5 min).
9
Reverse Transcription-PCR for Isoform-Specific Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To distinguish AS events, the reverse transcription (RT)-PCR was performed. Briefly, the RNA used for Iso-Seq was isolated using EZ-10 DNAaway RNA Mini-Preps Kit (Sangon, https://www.sangon.com ) and synthesized to complementary DNA using the Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR gDNA digester plus (Yeasen). Isoform-specific primers were designed using Vector NTI software (Supplementary Table S1 ). PCR amplification was performed using 2 × Taq PCR Master Mix (K1034, https://www.apexbt.com/ ) and the PCR products were showed in agarose gel stained with GoodView™ Nucleic Acid Stain (Apr-13-2021, HGV-II, https://www.sbsbio.com ).
BlazeTaq™ SYBR® Green qPCR Mix 2.0 (GeneCopoeia, USA) was used for RT-qPCR reactions on a CFX96 Real-time System (BIO-RAD, USA). The amplification program was briefly described in previous study [73 (link)]. To ensure the precise and reproducible results, each sample was replicated three times and Ef1α in potato were used for each sample as an endogenous control (Supplementary TableS1 ). The formula F = 2 –ΔΔCt was used to calculate the relative expression levels of selected genes.
BlazeTaq™ SYBR® Green qPCR Mix 2.0 (GeneCopoeia, USA) was used for RT-qPCR reactions on a CFX96 Real-time System (BIO-RAD, USA). The amplification program was briefly described in previous study [73 (link)]. To ensure the precise and reproducible results, each sample was replicated three times and Ef1α in potato were used for each sample as an endogenous control (Supplementary Table
10
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the EZ-10 DNAaway RNA Mini-Preps Kit (Sangon Biotech, Shanghai, China) according to the instructions of manufacturer. cDNA was generated using the Hifair® III 1st Strand cDNA Synthesis SuperMix (YEASEN, Shanghai, China). Diluted cDNA was mixed with the forward primer, reverse primer, SYBR Green PCR Master Mix (YEASEN, Shanghai, China), and RNase-free water in a 96-well plate. Analysis of mRNA expression was carried out using the Applied Biosystems QuantStudio 3. All samples were normalized to the level of GAPDH. The threshold cycles (Ct) for the control (GAPDH) and gene of interest were determined, and the relative mRNA levels were calculated by the 2 -t method. The details of the primer sequences used in the study are shown in the supporting information.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!