Pierce his protein interaction pull down kit
The Pierce™ His Protein Interaction Pull-Down Kit is a laboratory tool designed to facilitate the identification and analysis of proteins that interact with a target His-tagged protein. The kit provides the necessary components to perform pull-down assays, a commonly used technique in protein-protein interaction studies.
Lab products found in correlation
13 protocols using pierce his protein interaction pull down kit
PARP10 Interacting Protein Enrichment
Affinity Purification of Wnt and ATF Interactors
His-tagged PARP1 Protein Interactions
Protein-Protein Interaction Assays
Pull-down assays were performed using a Pierce™ His Protein Interaction Pull-down Kit (ThermoFisher Scientific, Waltham, MA, USA) [69 (link), 83 ]. The recombinant plasmids were transformed into Escherichia coli BL21 cells (TransGen Biotech, Beijing, China) and the fusion proteins were obtained by IPTG induction. The corresponding fusion protein combinations were incubated in nickel affinity chromatography. The eluent was tested with anti-GST and anti-HIS antibodies (Abmart, Shanghai, China).
For the BiFC assay, Agrobacterium solution containing recombinant plasmids was injected into tobacco leaves. The transformed tobacco plants were cultured under light conditions for 2 days. The fluorescence signals were observed using confocal microscopy.
Heterologous expression of human beta-defensin-2 in Pichia pastoris
Primers used in this study. (The DNA sequence of hBD-2 with primer annealing sites were given underlined and restriction cutting site were bold)
Primers | Sequences | References |
---|---|---|
5’AOX | 5´-GACTGGTTCCAATTGACAAGC-3´ | Invitrogen |
3’AOX | 5´-GCAAATGGCATTCTGACATCC-3´ | Invitrogen |
hBD-2 F2 | 5’G | This Study |
hBD-2 R1 | 5’G | This Study |
GAPDH F | 5’ AATGTTCGTTGTCGGTGTCA 3’ | This Study |
GAPDH R | 5’ GTCTTTTGAGTGGCGGTCAT 3’ | This Study |
In-vitro His-tag Pulldown Assay for Dynamin-2
His-CASP10 Binding Assay
Affinity Purification of DNAJA1-107 Interactors
His-CbpA Pull-Down Assay
Characterizing FaeG-APN Interactions
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!