Ptet on plasmid

The NSC34 motor neuronal-like cell lines were used in their neural-precursor form in continuation with our previous work. Cells stably transfected with pTet-ON plasmid (Clontech, Mountain View, CA, USA) harbouring sequences encoding for human SOD1 WT (NSC34-SOD1WT) or G93A mutant (NSC34-SOD1G93A) were a kind gift of prof. Maria Teresa Carrì (University of Tor Vergata, Rome, Italy) [18 (link)]. Cells were cultured in 5% CO₂ in DMEM/F12 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% tetracycline-free FBS (GIBCO, Waltham, MA, USA), penicillin/streptomycin antibiotic and 200 µg/mL G418 (Carlo Erba, Milan, Italy) for selection maintenance. The maximal expression of SOD1 proteins was achieved by the addition of 2 µg/mL doxycycline (Sigma-Aldrich) to the medium after 48 h. The parental NSC34 cells (CELLutions Biosystem Inc., Duluth, GA, USA) were used as control and cultured according to the manufacturer’s instructions. NSC34-SOD1WT and NSC34-SOD1G93A cells were plated in 96-well plates (10⁴ cells/well) and kept in a controlled environment (37 °C and 5% CO₂). After 24 h from doxycycline induction, 1, 5, 10, or 50 μg/mL of unlabeled NHK1, previously dissolved in DMSO, were diluted in the culture medium and cells were incubated for additional 24 h. Cell viability was assessed by MTT assay [39 (link)]. Parental NSC34 were used as control.

Mouse motor neuron-like hybrid NSC-34 cell line [51 (link)] was stably transfected with the pTet-ON plasmid (Clontech, Palo Alto, CA, USA), coding for the reverse tetracycline-controlled transactivator, used to construct inducible cell lines expressing the cDNAs encoding human wild-type-SOD1 (WT) or human SOD1 mutant G93A (G93A). Cells were transfected with human wild type SOD1 (WT) or mSOD1 G93A expressing vector, as previously described [39 (link)]. Cells were grown in a mixture of 1:1 Dulbecco’s modified Eagle’s medium (DMEM) and Ham’s F-12K Nutrient Medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 15 mM HEPES (Sigma-Aldrich, St. Louis, MO, USA), 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 100 U/mL penicillin and 100-μg/mL streptomycin (Sigma-Aldrich, St. Louis, MO, USA), and incubated at 37 °C in 5% CO₂. The expression of hSOD1 was induced by adding 2 µg/mL doxycycline (doxy; Sigma-Aldrich, St. Louis, MO, USA) to the culture medium for the last 24 h of culture.

To generate TRE-miR-29 mice, the mmu-miR-29a and mmu-miR-29b coding sequences were amplified by PCR from mouse genomic DNA (Forward Primer: 5′-GGACTTCACCTTCCCTCTCC-3′ and Reverse primer: 5′-ATTGGTTTGGCCCTTTATCC-3′), cloned into pTRE2 plasmid (Clontech) to generate pTRE-miR-29a,b1 cluster construct.
To generate ACTA1-rtTA mice, the promoter sequences were amplified by PCR from mouse genomic DNA (Forward Primer: 5′-TACTTGCCAGAGGTGACGGA-3′ and Reverse primer: 5′-GCTCTGACTCTGGCCCTGGG-3′), cloned into pTet-on plasmid (Clontech) instead of PCMV promoter to generate ACTA1-rtTA construct [15 (link)].
The TRE-miR-29a,b1 cluster transgenic mice and ACTA1- rtTA transgenic mice were generated using KUNMING mice, and backcrossed into the C57BL/6 mouse strain.
Generation of dual transgenic mice by crossing the TRE-miR-29a,b1 cluster mice and ACTA1-rtTA mice.
Mice were raised in controlled temperature (25 ± 1 °C) and humidity (60–70%) with a 12 h light, 12 h dark cycle.
The Evans Blue Dye (EBD) was injected i.p. into 28-day-old dTG mice and control mice 1 day before the sample collection [16 (link)].

The mouse motor neuron-like NSC34 cell line (CELLutions Biosystem Inc.), and/or the NSC34 cells stably transfected with pTet-ON plasmid (Clontech) harboring sequences encoding for SOD1 WT (NSC34-SOD1WT) or G93A (NSC34-SOD1G93A)17 (link) were used as ALS model cell line. Cell maintenance, induction, plasmids and transfection condition are explained in details in Supplementary Information.

HC11 mouse mammary epithelial cells were cultured in RPMI-1640 medium (R8758, Sigma) supplemented with 10% FBS (Hyclone), 10 ng/ml epithelial growth factor (EGF), 5 μg/ml insulin, and grown to 80% confluence, then changed into Opti-MEM medium without serum and antibiotics so that cells would be 90–95% confluent at the time of transfection. 4 μg of pTet-On plasmid (Clontech) were transfected using Lipofectamine^TM 2000 according to the manufacturer’s instructions. Positive clones were selected following treatment with 800 μg/ml G418 for 2 weeks. Clones were seeded into 24-well plates with RPMI-1640 medium and genotyped by PCR. Positive clones were co-transfected with TRE-miR31 plasmid and selection vector pTK-Hyg (Clontech) at a molar ratio of 20:1, and selected by addition of 600 μg/ml Hygromycin for 2 weeks. Surviving clones were PCR genotyped. No mycoplasma contamination was detected in any of the cultures using a mycoplasma detection kit.

pET32a-rtTA plasmid is obtained by means of inserting into HindIII/BamHI-digested pET32a a full-length of rtTA gene cassette, which was amplified by polymerase chain reaction (PCR) from pTet-On plasmid (Clontech Laboratories, Inc) using oligonucleotides rtTA1: (5′cccaagcttatgtctagactggacaagagc′) and rtTA2 (5′cgcggatccttacccggggagcatgtcaag 3′). Recombinant plasmid pET32a-rtTA was prepared according to standard mini-preparation of plasmid method.