Sybr green rt qpcr kit

Manufactured by Roche

Sourced in Switzerland

The SYBR® Green RT-qPCR kit is a reagent kit used for reverse transcription and real-time quantitative PCR (RT-qPCR) analysis. It contains all the necessary components to perform RNA reverse transcription and subsequent real-time PCR amplification and detection using the SYBR® Green fluorescent dye.

Automatically generated - may contain errors

Lab products found in correlation

Lightcycle 96, by Roche (1 mentions) Lightcycler 96, by Roche (1 mentions)

Close spelling variants of this product

SYBR Green Quantitative RT-qPCR Kit SYBR Green qPCR Kit SYBR® qPCR kit SYBR Green kit SYBR Green

2 protocols using sybr green rt qpcr kit

Quantitative RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cell RNA was extracted by using TRIzol. The mRNA was mixed with the PrimeScript RT Master Mix (Perfect Real Time; Takara, Japan) and RNase-free water, then reverse-transcribed into cDNA according to the manufacturer’s instructions. The primers used for RT-qPCR were listed in Table 1. qPCR was performed by the SYBR® Green RT-qPCR kit (Roche Diagnostics, Switzerland) and a Roche light cycle 96 (Roche, Switzerland). The GAPDH mRNA expression level is used for normalization, and the mRNA expression levels were calculated using the 2^−ΔΔcq method. We assigned an arbitrary value of 1 for each control expression level. The treated samples were evaluated as fold change over control.

Table 1

Primer sequences for PCR

Gene (mouse)	Primer sequence (3′→5′) forward	Primer sequence (3′→5′) reverse
Wnt5a	ATGCAGTACATTGGAGAAGGTG	CGTCTCTCGGCTGCCTATTT
Vangl2	GGGATGGGAGTCGTGGAGATA	TCATGGGAGATACTGTGCTCAG
MMP3	ACATGGAGACTTTGTCCCTTTTG	TTGGCTGAGTGGTAGAGTCCC
MMP9	CTGGACAGCCAGACACTAAAG	CTCGCGGCAAGTCTTCAGAG
MMP13	CTATCCCTTGATGCCATTACCAG	ATCCACATGGTTGGGAAGTTC
Col-2	CAGGATGCCCGAAAATTAGGG	ACCACGATCACCTCTGGGT
IL-6	CCAAGAGGTGAGTGCTTCCC	CTGTTGTTCAGACTCTCTCCCT
IL-8	CAAGGCTGGTCCATGCTCC	TGCTATCACTTCCTTTCTGTTGC
TNF-α	GACGTGGAACTGGCAGAAGAG	TTGGTGGTTTGTGAGTGTGAG

Zhang K., Li Z., Lu Y., Xiang L., Sun J, & Zhang H. (2021). Silencing of Vangl2 attenuates the inflammation promoted by Wnt5a via MAPK and NF-κB pathway in chondrocytes. Journal of Orthopaedic Surgery and Research, 16, 136.

+ Open protocol

+ Expand

Quantitative analysis of RNA expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from tissues and SMSCs was extracted using TRIzol^® reagent. The mRNA was then reverse-transcribed into cDNA using the PrimeScript RT Master Mix (Perfect Real Time; Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions. The following thermocycling conditions were used for RT: 37°C for 15 min, 85°C for 5 sec and cooled to 4°C. qPCR was performed using the SYBR^® Green RT-qPCR kit (Roche Diagnostics) and a Roche LightCycler 96 (Roche Diagnostics). The relative mRNA expression levels of AK094629, MAP3K4 and IL-6 were calculated using the 2^−ΔΔCq method (36 (link)), followed by normalisation to the GAPDH mRNA expression level. The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 10 sec; annealing at 58°C for 20 sec; and extension at 72°C for 30 sec, with a total of 45 cycles. The sequences of the primers used are listed in Table I. The amplification efficiencies of GAPDH, AK094629, IL-6, and MAP3K4 primers were 1.03, 0.87, 1.14 and 1.10, respectively.

Jia J., Sun J., Liao W., Qin L., Su K., He Y., Zhang J., Yang R., Zhang Z, & Sun Y. (2020). Knockdown of long non-coding RNA AK094629 attenuates the interleukin-1β induced expression of interleukin-6 in synovium-derived mesenchymal stem cells from the temporomandibular joint. Molecular Medicine Reports, 22(2), 1195-1204.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!