The total RNA in heart tissue was extracted with TRIzol reagent (Takara Bio., Shiga, Japan). The RNA sample from total RNA was reverse transcribed into cDNA using HiScript III RT SuperMix (Vazyme, Nanjing, China). RT-PCR was performed using the real-time PCR Kit (Vazyme, Nanjing, China) and the Bio-Rad Real-Time PCR System. GAPDH was used as an internal reference. The relative mRNA expression was calculated using the 2−ΔΔCt method. Gene-specific primers used in the study were: DPT, GGGGCCAGTATGGCGATTATG (forward), CGGTTCAAATTCACCCACCC (reverse); CCL5, CCAGCAGTCGTCTTTGTCAC (forward), CTCTGGGTTGGCACACACTT (reverse); GAPDH, ACAACTTTGGTATCGTGGAAGG (forward), GCCATCACGCCACAGTTTC (reverse).
Real time pcr kit
Manufactured by Vazyme
Sourced in China
The Real-time PCR Kit is a laboratory equipment used for the amplification and detection of specific DNA or RNA sequences in real-time. It provides a quantitative analysis of the target nucleic acid.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription kit, by Vazyme (2 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Real time pcr system, by Bio-Rad (1 mentions)
Hiscript 3 rt supermix, by Vazyme (1 mentions)
Hematoxylin eosin h e stain kit, by Beyotime (1 mentions)
Oil red o powder, by Merck Group (1 mentions)
Rna extraction kit, by Vazyme (1 mentions)
Pcr primers, by Sangon (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Ultrapure rna kit, by CoWin Biotech (1 mentions)
4 protocols using real time pcr kit
1
Analyzing Gene Expression in Heart Tissue
2
Histological Analysis of Diabetic Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oil-red O powder was purchased from Sigma Aldrich (St. Louis, MO, United States, O0625). All the real-time polymerase chain reaction (PCR) primers were purchased from Sangon (Shanghai, China). Hematoxylin–eosin (H&E) stain kit was purchased from Beyotime Biotechnology Co. (Beijing, China, C0105). RNA extraction kit and real-time PCR kit were purchased from Vazyme Biotech Co., Ltd. (Nanjing, China, Q311). Streptozotocin (STZ) was purchased from Selleck Co. (Shanghai, China, S1312).
3
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated using RNAiso Plus reagent (TaKaRa) and reverse transcribed into cDNA using reverse transcription kit (Vazyme Biotech). Quantitative real‐time PCR analysis was performed using real‐time PCR kit (Vazyme Biotech). The mixture was prepared by mixing 12.5 µL of Maxima SYBR Green qPCR Master Mix, 0.3 µM of forward and reverse primers and ≤ 500 ng of cDNA. Nuclease-free water was used to top up the mixture up to 25 µL. The reactions were incubated in a 96-well plate at 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s and then 95°C for 15 s, 60°C for 60 s, and 95°C for 15s. Expression level was calculated after normalization to the housekeeping gene expression.
4
Quantitative Analysis of RNA Expression in Luminal B Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from luminal B breast cancer tissues, matched adjacent non-tumor breast tissues, luminal B breast cancer cell lines, and human normal breast epithelial cell line using the Ultrapure RNA Kit (CW0581, ComWin Biotech Co., Ltd, China), following the manufacturer's instructions. The purity and concentration of the total RNA were detected by Nano Drop 2000. RNA was reversely transcribed into cDNA by the reverse transcription kit (Vazyme Biotech Co., Ltd) according to the manufacturer's protocol.
Real-time PCR was performed using the Vazyme Real-Time PCR Kit. 2 -ΔΔCT method was applied to calculate the relative expression of target genes, with GAPDH as the internal reference. The primer sequences used are displayed in Table 1.
Table 1 Primer sequences and siRNAs used in this study
Real-time PCR was performed using the Vazyme Real-Time PCR Kit. 2 -ΔΔCT method was applied to calculate the relative expression of target genes, with GAPDH as the internal reference. The primer sequences used are displayed in Table 1.
Table 1 Primer sequences and siRNAs used in this study
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!