The eGFP was amplified by PCR with the forward primer (CCGCTCGAGCGATGTCTAAAGGTGAAG) and reverse primer (CGCGGATCCTTATTTGTACAATTCATCCATACC). The amplified PCR product and the plasmid pIVEX2.4c were digested by XhoI and BamHI restriction enzymes (New England Biolabs). The larger fragment of pIVEX2.4c was recycled by DNA gel purification kit and the digested PCR fragment purified by PCR purification kit (Qiagen). These two fragments were mixed together and ligated by T4 DNA ligase (New England Biolabs). After transformation, the correct transformants were identified by restriction enzyme digestion.
Bamhi and xhoi restriction enzymes
Manufactured by New England Biolabs
Sourced in United States
BamHI and XhoI are type II restriction enzymes that recognize and cleave specific DNA sequences. BamHI recognizes the palindromic sequence 5'-GGATCC-3', while XhoI recognizes the palindromic sequence 5'-CTCGAG-3'. These enzymes are commonly used in molecular biology applications, such as DNA cloning, genotyping, and genetic engineering.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by New England Biolabs (2 mentions)
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Minelute reaction cleanup kit, by Qiagen (1 mentions)
Cloneamp hifi pcr premix, by Takara Bio (1 mentions)
Plvx ires puro, by Takara Bio (1 mentions)
Plasmid miniprep kit, by Promega (1 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
E coli bl21 de3 competent cells, by New England Biolabs (1 mentions)
Wizard plus sv miniprep and sv gel and pcr extraction kits, by Promega (1 mentions)
T3000 thermocycler, by Analytik Jena (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Avantor (1 mentions)
Pet30a, by Thermo Fisher Scientific (1 mentions)
Miniprep kit, by Qiagen (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
Sanger sequencing, by Genewiz (1 mentions)
9 protocols using bamhi and xhoi restriction enzymes
1
Cloning eGFP into pIVEX2.4c
2
Cloning Huntingtin Exon 1 Variants
3
Cloning Huntingtin Exon 1 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The entire exon 1 of Htt (Httex1) MATLEKLMKAFESLKSF [nQ]PPPPPPPPPPPQLPQPPPQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRPGS) with an nQ polyglutamine tract was cloned into a mammalian expression vector (pcDNA3·1(−), Invitrogen) using XhoI and BamHI restriction enzymes (New England Biolabs) resulting in CMV-promoter-controlled (CMV: cytomegalovirus) C-terminal fusion constructs of Httex1 to EYFP. Our studies used n = 25 as a non-pathogenic control, with n = 46 and 97 leading to aggregation.
4
Lentiviral Expression of HMGA2 Variant 1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral constructs were designed for let-7 resistant expression of HMGA2 variant 1 (HMGA2-OE) driven by the erythroid specific gene promoter region of the human SPTA1 gene (GRCh38/hg381; chromosome 1: 158,686,528–158,687,488), with a matched empty vector control. HMGA2 variant 1 was chosen because it is the only HMGA2 variant with let-7 binding sites in its 3’ UTR [20 (link), 21 (link)]. Lentiviral backbone pLVX-IRES-Puro (Cat. 632183) was purchased from Clontech (Mountain View, CA). To generate the SPTA1-IRES-Puro plasmid (empty vector control), the CMV promoter from the pLVX-IRES-Puro vector was replaced with the human SPTA1 promoter by directional cloning with ClaI and XhoI restriction enzymes as previously described [29 (link)]. The HMGA2 coding region with added XhoI and BamHI restriction sites for directional cloning was amplified by PCR from human genomic DNA with the following PCR primer pairs: HG2A 5'XhoI: 5' ACCCTCGAGTATGAGCGCACGCGGTGAGGG 3' ; V1HG2A 3'BamHI: 5' CCGGATCCCTAGTCCTCTTCGGCAGACTCTTGTGAGGAT 3' using CloneAmp HiFi PCR Premix (Clontech). The HMGA2 PCR product was digested with XhoI and BamHI restriction enzymes (New England Biolabs, Ipswich, MA) following manufacturer’s protocol and cleaned up with MinElute Reaction Cleanup Kit (Qiagen, Valencia, CA), followed by cloning into the pLVX-SPTA1-IRES-Puro vector to generate a pLVX-SPTA1-HMGA2-IRES-Puro plasmid.
5
Recombinant β-Lactamase Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA, PCR product purification, and gel extractions were performed using Wizard Plus SV miniprep and SV gel and PCR extraction kits (Promega). NdeI, BamHI, and XhoI restriction enzymes, T4 DNA ligase, and E. coli BL21(DE3) competent cells were purchased from New England Biolabs. All oligonucleotide primers for PCR amplification were purchased from Integrated DNA Technologies. All PCRs were performed with Phusion high-fidelity DNA polymerase and cloning performed in E. coli DH5α subcloning efficiency chemically competent cells (Thermo Fisher). The pET9a (StrateGene) expression clones were made using PCR amplification products from molecularly characterized clinical isolates carrying the desired β-lactamase gene and cloned NdeI to BamHI into pET9a in all cases. All β-lactamases were cloned with signal peptide encoding sequences. All transformants were verified by PCR amplification, restriction endonuclease mapping, and DNA sequencing. Confirmed expression plasmids were isolated with plasmid miniprep kits (Promega) and used to transform the expression cell line E. coli BL21(DE3) or E. coli JM109(DE3).
6
Recombinant SFTSV Nucleoprotein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For antigen production, the gene encoding the full-length NP protein of SFTSV strain LN3 (GenBank accession No. HQ141612) was expressed in a bacterial overexpression system. The S fragment of SFTSV was chemically synthesized using the Bioneer gene synthesis service (Bioneer, Korea). The 735 bp gene encoding N-protein was amplified using the following primers: SFTS-NP-1 CTCGGAATTCACATGTCA GAGTGGTCC and SFTS-NP-735 CTTCAAGCTTCAGGTT CCTGTAAGCAG. The PCR amplification was performed using a T3000 thermocycler (Biometra, Germany). The NP gene was cloned into pET-30a(+) (Invitrogen, USA) using the BamHI and XhoI restriction enzymes (New England Biolabs, UK), and subsequently transformed into Escherichia coli BL21 (DE3) (Yeastern Biotech, Taiwan) to express 6xHis-tagged fusion proteins. Following induction with 0.2 mM isopropyl β-D-1-thiogalactopyranoside (AMRESCO, USA) for 20 h at 25℃, the bacterial cell pellet was sonicated in chromatography buffer (20 mM sodium phosphate, 500 mM NaCl, 8 M Urea, and 20 mM imidazole, pH 7.4) and purified using Ni-NTA agarose (Qiagen, Germany) [22 (link)]. The affinity-purified protein was urea gradient dialyzed prior to use. The recombinant NP protein was solubilized in 8 M urea buffer, which was then exchanged for 150 mM Tris-HCl (iNtRon Biotechnology, Korea) for further use in subsequent experiments.
7
Lux Transcriptional Fusions in Y. pestis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Lux transcriptional fusions were generated by cloning a PCR product containing the corresponding regulatory region into the low-copy-number vector pCS26-Pac that carries the promoterless luxCDABE operon (62 (link)). PCR products were obtained with the 50R-BHI/50F-XhoI, 51R-BHI/51F-XhoI, 50R-BHI/51F-XhoI, 53R-BHI/53F-XhoI, 54R-BHI/54F-XhoI, 55R-BHI/55F-XhoI, and 54R-BHI/55F-XhoI primer pairs (Table S2). They were then digested with BamHI and XhoI restriction enzymes (NEB) and cloned into the pCS26-Pac plasmid previously digested with the same restriction enzymes, generating plasmids pCS::P50, pCS::P5x, pCS::P5x_51_50. pCS::P53, pCS::P54, pCS::P55, and pCS::P55_54, respectively (Table S1). Lux transcriptional fusion plasmids were transformed into the Y. pestis KIM6+ parental strain.
8
Cloning and Expression of mPNMA2 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequence (CDS) of mPNMA2, hPNMA2, myc-mPNMA2 1-170aa, myc-mPNMA2 171-365aa, myc-hPNMA2 1-170aa, and myc-hPNMA2 171-364aa, mPNMA2 L270QL325Q were synthesized by Integrated DNA Technologies (Coralville, IA). These fragments were digested by BamHI and XhoI restriction enzymes (New England BioLabs, Ipswich, MA), and ligated into pGEX-6p1 vector for protein expression and purification. The mPNMA2 CDS was amplified by PCR, digested by SalI and NotI, and cloned into the PRK5-myc vector. Similarly, pLVX-myc-mPNMA2, pLVX-mPNMA2, pLVX-mPNMA2 L270Q/L325Q, and pLVX-mPNMA2 Y162A were constructed by PCR amplification of mPNMA2 WT and L270QL325Q CDS, BamHI and XhoI digestion, and ligation into pLVX backbone between BamHI and XhoI sites. All ligation products were transformed into NEB Stable Competent E. coli (High Efficiency) (New England Biolabs, Ipswich, MA). Individual colonies were inoculated to isolate plasmids and screen for correct constructs by sequencing.
9
Recombinant Rep-domain Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A codon-optimized gene block of the Rep-domain sequence from human smacovirus 1 (HSV1), accession No. AJE25845.1, was synthesized by Integrated DNA Technologies. An N-terminal His6-SUMO tag and 15 nucleotides homologous to the parent vector, pTD68, were included for cloning. The parent vector was linearized with the BamHI and XhoI restriction enzymes (New England Biolabs) and the gene block was ligated in using an In-Fusion HD Cloning Kit (Takara) as per the manufacturer’s protocol. The ligated plasmid was transformed into competent Escherichia coli Stellar cells and plated onto 100 µg ml−1 ampicillin plates. After overnight incubation at 37°C, colonies were chosen and DNA was purified with a Qiagen Miniprep kit. Confirmation of the purified plasmid was performed by Sanger sequencing (Genewiz). Protein-production details are provided in Table 1 ▸ .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!