Log In Sign up
The largest database of trusted experimental protocols

Lmp vector

Manufactured by Thermo Fisher Scientific
Visit Supplier

The LMP vector is a laboratory instrument used for the analysis and manipulation of genetic material. It is designed to facilitate the cloning and expression of DNA sequences. The core function of the LMP vector is to provide a stable and controlled environment for the insertion, replication, and expression of genetic material in various experimental settings.

Automatically generated - may contain errors

Lab products found in correlation

Pgipz, by Horizon Discovery (2 mentions) Pgipz shrna clones, by Thermo Fisher Scientific (2 mentions) β actin, by Santa Cruz Biotechnology (2 mentions) Polybrene, by Merck Group (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

3 protocols using lmp vector

1

Cloning and Transduction of mCerk shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
A cDNA for mCerk (MMM1013-202798251, Open Biosystems) was subcloned into the pk1 vector. shRNAs targeting mCerk were designed using RNAi Central (http://katahdin.cshl.org/siRNA/RNAi.cgi?type=shRNA) and purchased from Open Biosystems. The following sequences were used: shCerk1 TGCTGTTGACAGTGAGC GCGCACTTGCTGGTATTCATCAATAGTGAAGCCACAGATGTATTGATGAATACCAG CAAGTGCTTGCCTACTGCCTCGGA; shCerk2 TGCTGTTGACAGTGAGCGAAGATTG TGTGTGTTACTCAACTAGTGAAGCCACAGATGTAGTTGAGTAACACACACAATCTG TGCCTACTGCCTCGGA. Oligonucleotides were cloned into the LMP vector (Open Biosystems) as described (39 (link)).
cDNA and shRNA plasmids were virally packaged using Plat-E cells (40 (link)), which were transfected with retroviral constructs using Lipofectamine® 2000 (Life Technologies). Supernatant containing viral particles was collected 48 hr post-transfection, filtered and used to infect primary tumor cell lines. Transduction was performed in the presence of 4 µg/ml polybrene (Millipore).
Payne A.W., Pant D.K., Pan T.C, & Chodosh L.A. (2014). Ceramide Kinase Promotes Tumor Cell Survival and Mammary Tumor Recurrence. Cancer research, 74(21), 6352-6363.
+ Open protocol
+ Expand
2

Knockdown of Epor and Klf1 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
pGIPZ shRNA clones (Openbio Systems, GE Dharmacon) against Epor and Klf1 were obtained from a Baylor College of Medicine Core. The Mir-30-based hairpin sequence was removed and cloned into to the LMP vector (Openbio Systems). shRNA clones (GE Dharmacon pGIPZ): shEpor: V3LMM_489985. shKlf1: V3LMM_489109. Knockdown efficiency of Epor and targets was confirmed by immunoblot with antibody targeting EPOR, β-ACTIN (Santa Cruz), JAK2, Phos-JAK2 (Y1007/1008), BCLXL (all Cell Signaling).
Zhang X., Su J., Jeong M., Ko M., Huang Y., Park H.J., Guzman A., Lei Y., Huang Y.H., Rao A., Li W, & Goodell M.A. (2016). DNMT3A and TET2 compete and cooperate to repress lineage-specific transcription factors in hematopoietic stem cells. Nature genetics, 48(9), 1014-1023.
+ Open protocol
+ Expand
3

Knockdown of Epor and Klf1 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
pGIPZ shRNA clones (Openbio Systems, GE Dharmacon) against Epor and Klf1 were obtained from a Baylor College of Medicine Core. The Mir-30-based hairpin sequence was removed and cloned into to the LMP vector (Openbio Systems). shRNA clones (GE Dharmacon pGIPZ): shEpor: V3LMM_489985. shKlf1: V3LMM_489109. Knockdown efficiency of Epor and targets was confirmed by immunoblot with antibody targeting EPOR, β-ACTIN (Santa Cruz), JAK2, Phos-JAK2 (Y1007/1008), BCLXL (all Cell Signaling).
Zhang X., Su J., Jeong M., Ko M., Huang Y., Park H.J., Guzman A., Lei Y., Huang Y.H., Rao A., Li W, & Goodell M.A. (2016). DNMT3A and TET2 compete and cooperate to repress lineage-specific transcription factors in hematopoietic stem cells. Nature genetics, 48(9), 1014-1023.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!