In brief, total RNA was extracted from cells using TRIzol reagent (Invitrogen), and RNA (1 μg) was reverse transcribed into cDNA using avian myeloblastosis virus reverse transcriptase (TaKaRa, Japan). The cDNA (1 μl of 25 μl) was then used in a SYBR green real-time PCR assay (Applied Biosystems). The abundance of individual mRNA transcripts in each sample was determined three times and normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. All quantitative PCR (qPCR) primers used in this study have been described previously (15 (link)).
Sybr green real time pcr assay
Manufactured by Thermo Fisher Scientific
SYBR green real-time PCR assay is a fluorescent dye-based method for quantifying nucleic acid targets in real-time PCR. It binds to double-stranded DNA, emitting a fluorescent signal that is proportional to the amount of DNA present in the sample.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using sybr green real time pcr assay
1
Real-Time PCR Analysis of mRNA
2
Cytokine Expression Analysis in PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples were extracted from PBMCs by Trizol regent (Invitrogen, USA), according to the manufacturer’s instructions. cDNAs were obtained using the RT System A3500 Kit (Promega, USA). The primer sequences were summarized in Table 2 . RT-PCR amplification reactions were performed using the SYBR Green Real-Time PCR assay and operated by the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). PCR products were amplified in duplicate in a total volume of 20 μl, verified by melting curve analysis. Relative mRNAs levels of target genes were calculated with normalization to β-actin values using the 2−ΔΔct method.
List of the sequence of human gene primers
| Gene name | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| IL-37 | AGTGCTGCTTAGAAGACCCGG | AGAGTCCAGGACCAGTACTTTGTGA |
| TNF-α | ACCTCTCTCTAATCAGCCCTCT | GGGTTTGCTACAACATGGGCTA |
| IL-1β | CCACAGACCTTCCAGGAGAAT | GTGCACATAAGCCTCGTTATCC |
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| IL-17 | ACCTCATTGGTGTCACTGCTAC | GTTCAGGTTGACCATCACAGTC |
| β-actin | CCTGACTGACTACCTCATGAAG | GACGTAGCACAGCTTCTCCTTA |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!