Log In Sign up
The largest database of trusted experimental protocols

IFIH1 is a laboratory equipment product from Thermo Fisher Scientific. It is a protein involved in the detection of double-stranded RNA, which can be an indicator of viral infection. The core function of IFIH1 is to recognize and bind to double-stranded RNA, triggering an immune response.

Automatically generated - may contain errors

Lab products found in correlation

M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Ifi16, by Thermo Fisher Scientific (1 mentions) Fx96 cycler, by Bio-Rad (1 mentions) Ifi44, by Thermo Fisher Scientific (1 mentions) Socs1, by Thermo Fisher Scientific (1 mentions) Taqman primer probe set, by Thermo Fisher Scientific (1 mentions) Mgcl2, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Tapestation 4200, by Agilent Technologies (1 mentions) Superreal premix sybr green, by Tiangen Biotech (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions)

2 protocols using ifih1

1

Quantifying Immune Response Transcripts in Neutrophils

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the RNeasy Mini kit following the manufacturer’s instructions (Qiagen, Hilden, Germany). RNA quality and quantification were determined by TapeStation 4200 (Agilent, St. Clara, USA) following the manufacturer’s instructions. Neutrophil total RNA was isolated using RNeasy Mini kit following the manufacturer’s instructions (Qiagen), and complementary DNA (cDNA) was synthesized using M-MLV Reverse Transcriptase (Thermo Fisher Scientific). RT-PCR was performed in duplicates using the cDNA and Platinum Taq polymerase (Thermo Fisher Scientific), 200 nM dNTP (Promega, Southampton, UK), 50mM MgCl2 (Thermo Fisher Scientific), and TaqMan primer/probe sets (Thermo Fisher Scientific). Samples were matched to a standard curve generated by amplifying serially diluted products using the same PCR reaction and normalized to GAPDH (Hs00266705_g1) to obtain the relative expression value. Real-time assays were run on FX96 Cycler (Bio-Rad). The following are the primes used: STAT1 (Hs01013996_m1), STAT2 (Hs01013115_g1), STAT3 (Hs00374280_m1), IFIH1 (Hs00223420_m1), IFIT (Hs00356631_g1), ISG15 (Hs00192713_m1), MX1 (Hs00895608_m1), IRF1 (Hs00971965_m1), SOCS1 (Hs00705164_s1), USP18 (Hs00276441_m1), IFI44 (Hs00197427_m1), IFI16 (Hs00986757_m1), and OAS (Hs00242943_m1) (all from Thermo Fisher Scientific).
Parackova Z., Vrabcova P., Zentsova I., Sediva A, & Bloomfield M. (2023). Neutrophils in STAT1 Gain-Of-Function Have a Pro-inflammatory Signature Which Is Not Rescued by JAK Inhibition. Journal of Clinical Immunology, 43(7), 1640-1659.
+ Open protocol
+ Expand
2

Gene Expression Analysis of Antiviral Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted by Trizol (Life Technologies) reagent according to the manufacturer's protocol. The acquired RNAs were treated with RNase-free DNase. Next, these RNAs were reverse transcribed to cDNA with oligo (dT). Precise gene manifestation was computed using SuperReal PreMix SYBR Green (FP204-02, TIANGEN, China). β-actin was used as the internal control for normalization. Following primers (Thermo Fisher) were utilized: IFIH1 sense (TCACAAGTTGATGGTCCTCAAGT), IFIH1 antisense (CTGATGAGTTATTCTCCATGCCC); IRF3 sense (AGAGGCTCGTGATGGTCAAG), IRF3 antisense (AGGTCCACAGTATTCTCCAGG); IRF7 sense (CCCACGCTATACCATCTACCT), IRF7 antisense (GATGTCGTCATAGAGGCTGTTG); IFIT1 sense (TTGATGACGATGAAATGCCTGA), IFIT1 antisense (CAGGTCACCAGACTCCTCAC); IFNB sense (GCTTGGATTCCTACAAAGAAGCA), IFNB antisense (ATAGATGGTCAATGCGGCGTC); M1 NS3 sense (GGGGAGGGCTTTCTTTGTCA), M1 NS 3 antisense (CACCCTGTCTTGTCTTTGCTG); β-actin sense (GATCATTGCTCCTCCTGAGC); β-actin antisense (ACTCCTGCTTGCTGATCCAC).
Liu Y., Li K., Zhu W.B., Zhang H., Huang W.T., Liu X.C., Lin Y., Cai J., Yan G.M., Qiu J.G., Peng L., Liang J.K, & Hu C. (2020). Suppression of CCDC6 sensitizes tumor to oncolytic virus M1. Neoplasia (New York, N.Y.), 23(1), 158-168.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!