Mirvana qrt pcr

Total RNA samples were extracted using Trizol (Invitrogen, USA) from cultural myocytes. miR-1 and miR-133a level were quantified by the mirVana qRT-PCR (quantitative real-time PCR) miRNA Detection Kit (Ambion, USA) in conjunction with real-time PCR with SYBR Green I (Applied Biosystems, USA), as previously described in detail [20 (link)]. Reverse transcription primers for miR-133a was: 5′-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCAGCTG-3′; miR-1 was: 5′-GGCTGCCGACCGTGTCGTGGAGTCGGCAATTGGTCGGCAGCCATACACAC-3. The following primers were used for PCR detection: 5′-GGGTTTGGTCCCCTTCAA-3′ (forward); 5′-AGTGCGTGTCGTGGAGTC-3′ (reverse). U6 was used as an internal control. The relative expression of miR-133a and miR-1 were calculated and normalized to U6 using the comparative Ct method. Relative expression intensity values were calculated as 2^−ΔΔCt.

Total RNA samples were extracted using Trizol (Invitrogen, USA) from cultural myocytes. MiR-155-5p, miR-145-5p and eNOS level were quantified by the mirVana qRT-PCR (quantitative real-time PCR) miRNA Detection Kit (Ambion, USA) in conjunction with real-time PCR with SYBR Green I (Applied Biosystems, USA) [21 (link)]. The following primers were used for PCR detection: miR-155-5p [5′-GCGCGTTAATGCTAATTGTGA-3′(forward); 5′-AGTGCAGGGTCCGAGGTATT-3′ (reverse)]; miR-145-5p [5′- CGGTCCAGTTTTCCCAGGAA − 3′ (forward); 5′ AGTGCAGGGTCCGAGGTATT − 3′ (reverse)], U6 was used as an internal control. eNOS [5′-TCC CAG ACC CCA TAA CAA CAG-3′ (sense) and 5′-TGA GGG TGC AGCGAA CTT TA-3′ (antisense)]. The relative expression of miR-155-5p, miR-145-5p and eNOS mRNA was calculated using the 2 − ΔΔCt method. All samples were run in triplicate from three independent experiments.