Log In Sign up
The largest database of trusted experimental protocols

Si hdac4

Manufactured by RiboBio
Visit Supplier
Sourced in China

Si-HDAC4 is a laboratory reagent designed for research purposes. It is a small interfering RNA (siRNA) targeting the HDAC4 gene, which encodes a histone deacetylase enzyme involved in chromatin remodeling and gene expression regulation. Si-HDAC4 can be used to study the functional role of HDAC4 in various biological processes.

Automatically generated - may contain errors

Lab products found in correlation

Mir 520b, by RiboBio (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Si dnmt1, by RiboBio (1 mentions) Siegr1, by RiboBio (1 mentions)

2 protocols using si hdac4

1

miR-520b Regulation of HDAC4 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were grown on 6‐well, 24‐well, or 96‐well plates for 24 hours. Lipofectamine 2000 (Invitrogen) was used as a reagent to perform transient transfection of miRNAs or small interfering RNAs (siRNAs). MiR‐520b, control (Ctrl), MiR‐520b inhibitor, and si‐HDAC4 were purchased from RiboBio (Guangzhou, China).
Jin K., Zhao W., Xie X., Pan Y., Wang K, & Zhang H. (2018). MiR‐520b restrains cell growth by targeting HDAC4 in lung cancer. Thoracic Cancer, 9(10), 1249-1254.
+ Open protocol
+ Expand
2

Regulation of Gene Expression via RNA Interference

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR‐1281 mimic, inhibitor, and their corresponding negative controls, small interfering (si)‐EGR1, si‐HDAC4, si‐DNMT1, and the negative control si‐negative control were chemically synthesized by Ribobio (China). The siRNA sense sequences designed were as follows: EGR1, 5′‐CCAACAGTGGCAACACTTT‐3′; si‐HDAC4, 5′‐GGATGAGCCCTACCTAGAT‐3′; and si‐DNMT1, 5′‐TATTGGTGCATACTCTGGGCT‐3′.
Li Y., Li L., Qian Z., Lin B., Chen J., Luo Y., Qu J., Raj J.U, & Gou D. (2018). Phosphatidylinositol 3‐Kinase–DNA Methyltransferase 1–miR‐1281–Histone Deacetylase 4 Regulatory Axis Mediates Platelet‐Derived Growth Factor–Induced Proliferation and Migration of Pulmonary Artery Smooth Muscle Cells. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 7(6), e007572.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!