Thermoscript reverse transcriptase pcr rt pcr system

CSF, plasma, brain and the axillary lymph nodes were collected from animals at the time of necropsy and cryopreserved. The viral RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen). All animals used in this study were perfused with saline prior to sample collection to avoid blood contamination in the tissues. Fresh brain tissue was collected from the frontal, parietal, and temporal lobes, the cerebellum, and the midbrain during necropsy and homogenized together using the cell strainer to obtain single cell suspensions. Fresh axillary lymph node was collected and homogenized using the cell strainer to obtain single cell suspension. Total RNA was extracted from the brain and axillary lymph node using RNeasy Mini Kit (Qiagen) and then treated with DNase I (Invitrogen, Grand Island, NY) to digest residual genomic DNA. The viral RNA was reverse transcribed using a Thermoscript reverse transcriptase PCR (RT-PCR) system (Invitrogen) and the primer 9341-R (CATCATCCACATCATCCATG). The envelope DNA fragment was amplified by PCR with Platinum taq DNA polymerase (Invitrogen) and primers 6463-F (GGTGTTGCTATCATTGTCAGC) and 9341-R and then subcloned into the pCR4-TOPO vector by use of a TOPO TA cloning kit (Invitrogen) for sequencing. A minimum of 10 clones were selected for each sample from each of five macaques, and the complete envelope gene was sequenced.