The 16S rRNA gene of the bacterial endophyte was amplified according to a method described by Kuklinsky-Sobral et al. [28 ]. DNA extraction was done using a ZR Fungal/Bacterial Kit™ (Zymo Research, catalog NO R2014) according to the manufacturer's instructions. Polymerase chain reaction (PCR) was done to amplify the 16S rRNA gene of each bacterial endophyte with the primers 16S-27F: 5′-AGAGTTTGATCMTGGCTCAG-3′ and 16S-1492R: 5′-CGGTTACCTTGTTACGACTT-3′, using DreamTaq™ DNA polymerase (Thermo Scientific™). PCR products were gel extracted (Zymo Research, Zymoclean™ Gel DNA Recovery Kit) and sequenced in the forward and reverse directions on the ABI PRISM™ 3500xl Genetic Analyzer. The sequencing was performed at Inqaba Biotechnical Industries (Pty) Ltd., Pretoria, South Africa. The PCR products were cleaned with ExoSAP-it™ following the manufacturer's recommendations. Purified sequencing products (Zymo Research, ZR-96 DNA Sequencing Clean-up Kit™) were analyzed using CLC Main Workbench 7, followed by a BLAST search (NCBI).
Zr fungal bacterial kit
Manufactured by Zymo Research
The ZR Fungal/Bacterial Kit™ is a DNA/RNA extraction kit designed to isolate nucleic acids from a variety of fungal and bacterial samples. The kit utilizes a bead-beating technology to efficiently lyse cells and release the genetic material, which is then purified using spin columns. The extracted nucleic acids can be used for downstream applications such as PCR, sequencing, or other analyses.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using zr fungal bacterial kit
1
Bacterial Endophyte 16S rRNA Sequencing
2
Bacterial Endophyte 16S rRNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction was done using a ZR Fungal/Bacterial Kit™ (Zymo Research, catalog no. R2014) according to the manufacturer's instructions. Polymerase chain reaction (PCR) was done to amplify the 16S rRNA gene of each bacterial endophyte with the primers 16S‐27F: 5′‐AGAGTTTGATCMTGGCTCAG‐3′ and 16S‐1492R: 5′‐CGGTTACCTTGTTACGACTT‐3′, using DreamTaq™ DNA polymerase (Thermo Scientific™). PCR products were gel extracted (Zymo Research, Zymoclean™ Gel DNA Recovery Kit), and sequenced in the forward and reverse directions on the ABI PRISM™ 3500xl Genetic Analyser. The sequencing was performed at Inqaba Biotechnical Industries (Pty) Ltd. The PCR products were cleaned with ExoSAP‐it™ following the manufacturer's recommendations. Purified sequencing products (Zymo Research, ZR‐96 DNA Sequencing Clean‐up Kit™) were analyzed using CLC Main Workbench 7, followed by a BLAST search (NCBI) (Kuklinsky‐Sobral, Arajo, Mendes, Pizzirani‐Kleiner, & Azevedo, 2005 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!