Lipofectamine messengermax mrna transfection reagent

For the pcDNA6B vector containing the T7 promoter, the DNA was linearized with AgeI digestion followed by gel purification. For the PCR product, the primers included the T7 promoter (TTAATACGACTCACTATAGGGTGGAATTCTGCAGATATCCAG, T1427), generating the DNA fragment containing target gene, LG or QLG dual reporter, and a poly(A) tail. PCR was performed using the Phusion High-Fidelity PCR Master Mix kit (Thermo Fisher Scientific, F531). The DNA was purified using gel extraction kit and the concentration determined using the Take3 plate in a BioTek Synergy LX multiplate reader. RNA was synthesized from the purified DNA template using the HiScribe T7 ARCA mRNA Kit (NEB, cat. no. E2060) with or without N1-methyl-pseudouridine (Trilink, San Diego, CA, cat. no. N-1081) and co-transcriptionally capped with m7G anti-reverse cap analog (ARCA, cat. no. 1411) and poly(A) tailing. The synthesized RNA was purified using Monarch RNA cleanup kit (NEB, cat. no. E2040) and quantified using the Take3 plate. Equal amounts of RNA between LG and QLG groups at different dosages were used for transfection into HEK293T cells in quadruplicate with Lipofectamine MessengerMAX mRNA Transfection Reagent (Thermo Fisher Scientific, cat. no. LMRNA015) following the manufacturer’s manual. At 4–72 h posttransfection, the culture media containing gdLuc were collected, and the gdLuc assay was performed as above.