Total RNA extraction from 108 promastigotes was performed using TRIzol isolation reagent (Thermo Fisher Scientific) as described previously [19 (link)]. Fifty mg of total RNA from each sample were treated with RNase-free DNase I (New England Biolabs, Ipswich, USA) and S1 nuclease from Aspergillus oryzae (Sigma–Aldrich) according to the manufacturer’s instructions. Viral dsRNA bands were visualized on 0.8% agarose gel and stained with ethidium bromide. Individual dsRNA bands were gel purified using a Zymoclean Gel RNA Recovery Kit (Zymo Research, Irvine, CA, USA). RiboMinus libraries were generated and sequenced using the Illumina NovaSeq platform (Illumina, San Diego, CA, USA) at Macrogen Inc. (Seoul, South Korea).
Trizol isolation reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States, Belgium, Italy
TRIzol is a reagent used for the isolation and purification of total RNA from a variety of biological samples, including cells, tissues, and microorganisms. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitates the separation of RNA from DNA and proteins during the extraction process. The reagent effectively disrupts cells and denatures proteins, allowing for the efficient recovery of high-quality RNA that can be used in various downstream applications, such as RT-PCR, Northern blotting, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Primer express design software, by Thermo Fisher Scientific (2 mentions)
Ssofast evagreen supermix, by Bio-Rad (2 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Promega (2 mentions)
Rnase free dnase 1, by New England Biolabs (1 mentions)
Novaseq platform, by Illumina (1 mentions)
Zymoclean gel rna recovery kit, by Zymo Research (1 mentions)
Reverse transcription system, by Promega (1 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions)
Experion stdsens analysis kit, by Bio-Rad (1 mentions)
42 protocols using trizol isolation reagent
1
Viral dsRNA Extraction and Sequencing
2
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol isolation reagent (Thermo Fisher Scientific) was used to extract total RNA from the cultured cells according to the manufacturer’s protocol. Then, first-strand cDNA was synthesized through Reverse Transcription System (A3500; Promega Corporation, Fitchburg, WI, USA). The relative expression level of mRNA was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR). The PCR reaction was performed at 95°C for 8 minutes followed by 38 cycles at 95°C for 15 seconds and 57°C for 60 seconds. Specific primers to MLL1, CCND1, CCNE1, p21, and p27 were used, and GAPDH mRNA levels were used as internal control.
3
Quantifying Apoptosis and Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh sections of harvested kidney and liver tissues were rinsed with ice-cold PBS; thereafter, they were used to extract the total mRNA using Trizol isolation reagent (Thermo Scientific, MA, USA). The extracted mRNA was quantified, and 300 ng/weight was used for cDNA determination for both apoptotic and inflammatory marker expressions. The forward primers (GAAATTCCTGATCCAGACAAAAAC, TGGACCTTCCAGGATGAGGACA and GCAAGGATACTGAGAGCAAGAG) and reverse primers (ATCACTTCAATGGCCTCTGTGTAG, GTTCATCTCGGAGCCTGTAGTG and GGATGGAATTGTGAGGGAGATG) for NF-κB, IL-1β and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), respectively, were used. The expression of cDNA products was investigated using method detailed by Ibrahim et al. [31 (link)].
4
Quantitative Analysis of PGC-1α and Fis1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1 µg) was extracted from 50 mg of spleen tissue using 800 µl of Trizol isolation reagent (Thermo Fisher Scientific, Waltham, USA). RNA concentration was determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, USA). RNA was then reversetranscribed into cDNA using a cDNA synthesis Master Mix (LeGene Biosciences, San Diego, USA). Real-time PCR reactions were conducted on the CFX Connect Real-Time PCR Detection System (Bio Rad, Hercules, USA) using SB-Green qPCR Master Mix (LeGene Biosciences, San Diego, USA). PGC-1α and Fis1 sequences are shown in Table 2.
Thermal cycling parameters were as follows: 95℃ for 2 minutes, followed by 40 cycles at 95℃ for 10 seconds, annealing at 60℃ for 15 seconds, extension at 60℃ for 30 seconds, and a melting curve analysis performed at 95℃ for 10 seconds and 65℃ for 5 seconds. Results were expressed as fold change and calculated using the comparative 2 -ΔΔCT method [11] (link).
Thermal cycling parameters were as follows: 95℃ for 2 minutes, followed by 40 cycles at 95℃ for 10 seconds, annealing at 60℃ for 15 seconds, extension at 60℃ for 30 seconds, and a melting curve analysis performed at 95℃ for 10 seconds and 65℃ for 5 seconds. Results were expressed as fold change and calculated using the comparative 2 -ΔΔCT method [11] (link).
5
Muscle Total RNA Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Muscle LL samples were subjected to extraction and evaluation of gene expression. Isolation of total RNA from muscle was performed using Trizol Isolation Reagent (Life Technologies Australia Pty Ltd., Mulgrave, Australia) and PureLink RNA Mini Kit (Ambion, Life Technologies Australia Pty Ltd., Mulgrave, Australia) following the protocol recommended by the manufacturer. The extracted RNA was then diluted with 50 µL of RNase free water and stored at −80 ℃ until analysis performed.
The quality and quantity of the RNA extracted were evaluated by the Experion System Automated Electrophoresis Station (Bio-Rad Laboratories Inc., Gladesville, NSW, Australia) with the Experion StdSens Analysis Kit (Bio- Rad Laboratories Inc., Gladesville, NSW, Australia). For determination of RNA concentration and the ratio of 28S to 18S, the electropherograms were analysed for each sample. All the samples had an RNA quality indicator (RQI) higher than 9.0. Total RNA (8 μL) was then reverse transcribed into cDNA using Superscript™ III First-Strand Synthesis System Reagents (Invitrogen Life Technologies Pty Ltd., Mulgrave, Vic, Australia, #18080051) for reverse transcription polymerase chain reaction (RT-PCR) according to the protocol recommended by the manufacturer. Random hexamers were used as the primer during cDNA synthesis.
The quality and quantity of the RNA extracted were evaluated by the Experion System Automated Electrophoresis Station (Bio-Rad Laboratories Inc., Gladesville, NSW, Australia) with the Experion StdSens Analysis Kit (Bio- Rad Laboratories Inc., Gladesville, NSW, Australia). For determination of RNA concentration and the ratio of 28S to 18S, the electropherograms were analysed for each sample. All the samples had an RNA quality indicator (RQI) higher than 9.0. Total RNA (8 μL) was then reverse transcribed into cDNA using Superscript™ III First-Strand Synthesis System Reagents (Invitrogen Life Technologies Pty Ltd., Mulgrave, Vic, Australia, #18080051) for reverse transcription polymerase chain reaction (RT-PCR) according to the protocol recommended by the manufacturer. Random hexamers were used as the primer during cDNA synthesis.
6
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted with TRIzol® isolation reagent (Life Technologies) from cells followed by DNase treatment and reverse transcription to synthesize cDNA with Moloney Murine Leukemia Virus Reverse Transcriptase (Promega). TaqMan® chemistry with primers and probes (Life Technologies): CDKN1B (#4331182; 151 bp, Hs01597588_m1, NM_004064.3 ), CDKN1C (#4331182; 91 bp, Hs00175938_m1, NM_000076.2 , NM_001122630.1 , NM_001122631.1 ), SKP2 (#4331182; 59 bp, Hs01021864_m1, NM_001243120.1 , NM_005983.3 , NM_032637.3 ) and GAPDH (#4453320; 93 bp, Hs02758991_g1, NM_001256799.1 , NM_002046.4 ) were used for quantitative RT-PCR. The relative expression folds of each target transcript were given by 2−ΔΔCT, where ΔΔCT = ΔCT (treatment) – ΔCT (DMSO); ΔCT represented the CT of a target transcript subtracted from the CT of GAPDH (internal control). Only samples with CT value < 25 for GAPDH were considered to meet acceptable RNA quality standards and included in the analyses.
7
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used TRIzol isolation reagent (Life Technologies, MD, USA) to extract total RNA from cells, according to the manufacturer’s instructions. Next, we reverse transcribed the extracted RNA to cDNA using a high-capacity cDNA reverse transcriptase kit (Vazyme, Nanjing, China). Quantitative real-time PCR fluorescence was performed in triplicates using a Chromo4 cycler (Bio-Rad, CA, USA) and SYBR Green PCR Master Mix Kit with specific primers (Table S1 ). The expression levels of all genes were normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
8
Liver RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen liver samples using TRIzol Isolation Reagent (Life Technologies, Belgium). cDNA was synthesized from 1μg RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Lennik, Belgium). Real time PCR analysis was performed in duplicate with the StepOnePlus real-time PCR System (Applied Bio-systems, Lennik, Belgium) using SYBRgreen. Primer pairs for transcripts of interest were designed using primer express design software (Applied Biosystems, Lennik, Belgium) and are listed in Supplementary Table 1 . RPL19 mRNA was chosen as an invariant standard. Results are expressed as fold expression relative to expression in the control group using the ΔΔCt method.
9
Quantifying Gene Expression in Myocardial Infarction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen myocardial tissue from the infarcted, adjacent, and remote areas of the pigs was homogenized in TRIzol isolation reagent (Life Technologies, Madrid, Spain) for RNA isolation. RT-qPCR was performed using an ABI Prism 7900 sequence detection system (Life Technologies, Madrid, Spain) with TaqMan Gene Expression Assays (Life Technologies, Madrid, Spain). The fold change in gene expression from the control group was calculated using the 2−ΔΔCt method [10 (link)].
10
Liver RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen liver samples using TRIzol Isolation Reagent (Life Technologies, Belgium). cDNA was synthesized from 1 μg RNA using a High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Lennik, Belgium). Real‐time PCR analysis was carried out in duplicate with the StepOnePlus real‐time PCR System (Applied Biosystems) using SYBR green. Primer pairs for transcripts of interest were designed using primer express design software (Applied Biosystems) and are listed in Table 1 . RPL19 mRNA was chosen as an invariant standard. Results are expressed as fold expression relative to expression in the control group using the ∆∆Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!