Single-cell clones were allowed to expand to a 48 well plate, then harvested genotyping and western blot analysis. Genomic DNA was isolated using QuickExtract (Epicentre), incubated at 65°C for 6 minutes followed by an incubation at 95°C for 2 minutes using a thermal cycler. For genomic PCR, primers targeting the genomic loci outside of the gBlock's homology arms and primers internal to each resistance cassette were used to confirm site-specific insertion of resistance cassettes and the loss of wild-type amplicon.
Quickextract
Manufactured by Illumina
Sourced in United States
QuickExtract is a laboratory sample preparation product designed to rapidly extract DNA or RNA from a variety of sample types. It provides a fast and convenient method for preparing nucleic acid samples for downstream analysis or applications.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (8 mentions)
Opti mem, by Thermo Fisher Scientific (4 mentions)
Penicillin streptomycin, by Avantor (3 mentions)
Fetal bovine serum (fbs), by Avantor (3 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (2 mentions)
Pspcas9 bb 2a puro, by Addgene (2 mentions)
Pcr4 topo ta, by Thermo Fisher Scientific (2 mentions)
Kapa2g robust pcr kit, by Avantor (2 mentions)
Fugene hd, by Promega (2 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (2 mentions)
Dmem f 12 50 50 media, by Corning (2 mentions)
Pcr cloning kit, by New England Biolabs (2 mentions)
Neon transfection system, by Thermo Fisher Scientific (2 mentions)
Methocult h4100, by STEMCELL (2 mentions)
Spcas9 bb 2a gfp vector, by Addgene (2 mentions)
T7 endonuclease 1, by New England Biolabs (2 mentions)
Exosap it, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Sureclean, by Meridian Bioscience (1 mentions)
43 protocols using quickextract
1
Single-cell clone expansion and genotyping
2
Mitochondrial DNA Sequencing of Sperm Whale Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of the sperm whale skin and skeletal muscle were collected and frozen at −20 °C. Samples of DNA were extracted from each tissue type using QuickExtract (Epicentre, Madison, WI, USA) following the manufacturer’s protocols. Two replicate for each tissue type was done to minimize the likelihood of reporting erroneous sequences because of sequencing error. A section of the mitochondrial DNA control region was targeted using primers and PCR protocols from Southern, Southern & Dizon (1988) (link) with a negative control. The resulting PCR product was visualized under UV light after GelRed™ agarose gel electrophoresis. Successful product from PCR was purified using SureClean (Bioline). Cycle sequencing was performed using BigDye Terminator PCR (Applied Biosystems, Foster City, CA, USA) in both directions following the manufacturer’s instructions. The resulting single-stranded DNA were purified with CleanSEQ magnetic beads (Agencourt Bioscience Corp), and sequenced on an ABI 3100xl genetic analysis sequencer (Applied Biosystems). The resulting sequences were aligned and edited using the software Sequencher (Gene Codes Corporation, Ann Arbor, WI, USA), and haplotype matching followed Engelhaupt et al. (2009) (link).
3
High-throughput Sequencing of Macrofaunal and Zooplankton Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forty-six macrofaunal samples, along with all zooplankton samples, were sequenced using high-throughput sequencing (HTS; Suppl. material 4 ). PCR was performed on genomic DNA extracted using QuickExtract (Epicenter, BuccalAmpTM) or directly on selected samples for improved time efficiency (Wong et al. 2014 (link)). A short 313-bp fragment of the COI gene was targeted using either the mlCO1intF and rmHCO2198 primer pair (Folmer et al. 1994 (link), Meier et al. 2015 (link)) or reaction mix (3) (see section on macrofaunal COI barcode amplification) with forward and reverse primers that were uniquely labelled with 9-bp tags (generated with online freeware “Barcode generator”; http://comailab.genomecenter.ucdavis.edu/index.php/Barcode_generator ) that differed from one another by ≥ 3-bp (Meier et al. 2015 (link)). Each 20-μl PCR reaction contained 1× GoTaq® Green Master Mix, 0.5 μM of each uniquely labelled primer and 2 μl of DNA extract. PCR thermal cycling conditions were as follows: an initial denaturation step at 94°C for 60 s, followed by 35 cycles of 94°C for 60 s, 47°C for 120 s, 72°C for 60 s, and 72°C for 3 mins.
4
Generation of Genetically Engineered HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T knockout cell lines were generated by transient transfection of pSpCas9(BB)-2A-Puro (Addgene #48139) encoding U6 driven expression of sgRNAs (Scramble Guide: GCACTACCAGAGCTAACTCA; ATG7 Guide: ACACACTCGAGTCTTTCAAG; ATG12 Guide: CCGTCTTCCGCTGCAGTTTC; ATG14 Guide: CTACTTCGACGGCCGCGACC; FIP200 Guide: AGAGTGTGTACCTACAGTGC). Cells were selected 48–72 hours post-transfection with 1μg/ml puromycin for 48 h. Polyclonal populations were collected for Surveyor analysis (IDT, 706020) and were sorted into single-cell populations by limiting dilution at 1.5 cells/well per 96-well plate. For DNA analysis, genomic DNA samples were prepared using QuickExtract (Epicentre). The PCR products were column purified and analysed with Surveyor Mutation Detection Kit (IDT). For genotyping of single-sorted cells, PCR amplified products encompassing the edited region (ATG7 Fw: TGGGGGACAGTAGAACAGCA, ATG7 Rev: CCTGGATGTCCTCTCCCTGA; ATG12 Fw: AGCCGGGAACACCAAGTTT, ATG12 Rev: GTGGCAGCCAAGTATCAGGC; ATG14 Fw: AAAATCCCACGTGACTGGCT, ATG14 Rev: AATGGCAGCAACGGGAAAAC; FIP200 Fw: ATTCTCTGGCTTGACAGGACAG, FIP200 Rev: AAATACTGAGCGTGCACATTGC) were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher #450030) and sequence verified. Sequencing is available upon request.
5
Conditional Degradation of CPSF73 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CPSF73 gene was tagged with a C-terminal FKBP degron by the MMEJ homology method described by Nabet et al. (2018) (link). CPSF73 homology arms were inserted into the plasmid pCRIS-PITChv2-dTAG-BSD (BRD4) according to the protocol provided by Nabet et al. The gRNA (GGCTGCACAGAGACTGTACG) was inserted into the Cas9 vector GW223-pX330A-sgX-sgPITCh. Both plasmids were a kind gift from the Mayer Lab. The plasmids were transfected into MRC5-VA cells using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific) and selected with 5ug/ml Blasticidin (Cambridge Bioscience). Single clones were isolated and the genomic DNA prepared using QuickExtract (Epicentre Technologies) and ExoSapIT (Applied Biosystems). The region surrounding the tag insertion site was amplified with primers ATTAGGACCGTGCTGCTGTC and CCTGTAACACCCACGAGGAC using Q5 polymerase (New England bioLabs). Clones with a PCR product of 3036 bp were expanded and analysed by Western blot using either antibodies to HA (ab 236632 Abcam Ltd) or CPSF73 (A301-090 Bethyl Laboratories Inc). Genomic DNA was sequenced to ensure correct insertion of the degradation tag. Homozygous clones were treated with dTAG-7 (Tocris, Bio-Techne Ltd.) at 250nM for 2h and the degradation of CPSF73 confirmed by Western blot.
6
Organoid DNA Extraction and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells from different stages of the organoid protocol were collected (iPS cell, embryoid body, embedded organoids and organoids day 30). QuickExtract (30–60 µl, Epicentre, QE0905T) was added to the cell pellets or organoids and the suspension was incubated at 65 °C for 10 min, 68 °C for 5 min and 98 °C for 5 min to extract the DNA. The same PCR was used to validate the library complexity of the plasmid library17 (link). The PCR was performed using the KAPA2G Robust PCR Kit (Peqlab, 07-KK5532-03) using the supplied buffer B and 5 µl isolated DNA. The following program was used: 95 °C for 3 min; 35 cycles of 95 °C for 15 s, 65 °C for 15 s and 72 °C for 15 s; 72 °C for 60 s. Libraries were sequenced using the Illumina MiSeq system (Nano kit) .
7
CRISPR-mediated ADNP Knockout and Knockin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate ADNP knockout, knock in, and homeodomain deletion cell lines with CRISPR/cas9, design of guide RNAs was carried out using the CRISPR Design Tool (https://zlab.bio/guide-design-resources ) and inserted into PX459, a gift from Feng Zhang (Addgene plasmid: 62988)77 (link) or into lentiCRISPRv2 Blast, a gift from Brett Stringer (Addgene plasmid: 98293)78 (link). To generate pCDNA3-ADNP donor plasmid, gBlock gene fragments were synthesized (IDT) and inserted into pCDNA3 using NEBuilder. To generate ADNP knockout cell lines for CRISPRa system, guide RNAs were inserted into CRISPRa-sgRNAs were designed according to Konermann et al.64 (link) and inserted into pLentiV2-dCas9-VP64, a gift from Igor Ulitsky (Addgene plasmid: 141104). 1 µg guide RNAs and 1.5 µg donor plasmid were transfected into mESC cell line. ADNP knock in and homeodomain deletions candidate clones were confirmed by PCR using the extracted DNA that was isolated using QuickExtract (Epicentre QE09050), and further confirmed using western blot. All primer sequences can be found in Supplementary Table 1 . All cell lines generated in this study are available upon request.
8
CRISPR-Mediated FOXM1 Knockout Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR-mediated FOXM1 knockout was performed as previously described [71 (link)]. Briefly, Lipofectamine 2000 (Life Technologies) was used to transfect HEK293T cells with PX458 (Addgene #48138) containing FOXM1 guide RNAs targeting near FOXM1 start and stop codons (462-TGAGAATCAGTGGCCGACGG and 897-CACCGGTCTAAGGGTTCTGAACTG, respectively). The guide RNAs were designed using the Genetic Perturbation Platform Web Portal (https://portals.broadinstitute.org/gpp/public/ ) and the highest scoring guide RNAs were then empirically tested for their cutting efficiency. Isolation of clonal cell lines was achieved with fluorescence-activated cell sorting (FACS) following by plating of GFP positive cells into 96-well dishes for clonal growth. DNA was isolated from clones with QuickExtract (Epicentre Technologies, Thane, Maharashtra, India) for genotyping and replica plated for clonal expansion. Genotyping was performed by PCR with annealing temperature of 60 °C and 30 cycles for all primer pairs listed in Table S5 . Primers were designed with NCBI Primer-BLAST then empirically tested by gradient end-point PCR to optimize the specificity and sensitivity.
9
Targeted DNA Sequencing of GLI3 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell pellets of picked colonies were resuspended in 10 µl QuickExtract (Epicentre, QE0905T) and the suspension was incubated at 65 °C for 10 min, 68 °C for 5 min and 98 °C for 5 min to extract the DNA. A PCR reaction was performed with primers containing Illumina sequencing adapters for the targeted locus of the GLI3 gene. Amplification was performed using the KAPA2G Robust PCR Kit (Peqlab, 07-KK5532-03) using the supplied buffer B and 2 µl of extracted DNA. The following program was used: 95 °C for 3 min; 35 cycles of 95 °C for 15 s, 65 °C for 15 s and 72 °C for 15 s; and 72 °C for 60 s. Unique P5 and P7 Illumina indices were added to 0.5 µl of the previous PCR product with a second PCR program (98 °C for 30 s; 25 cycles of 98 °C for 10 s, 58 °C for 10 s and 72 °C for 20 s); and 72 °C for 5 min), using the Phusion HF MasterMix (Thermo Fisher Scientific, F-531L). The double-indexed libraries were pooled and purified with SPRI beads. Purified libraries were sequenced on the MiSeq (Illumina) system resulting in paired-end sequences of 2 × 150 bp. LeeHom51 (link) was used to trim the adapters after base calling using Bustard (Illumina).
10
Genotyping Mouse Embryos by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The embryos were lysed in 10 µL of Quick Extract (EPICENTRE) and used as a template for PCR. The primer set ATP6c_wt_Fw (5′-AGGCTCTCCTGGCCCAGCCGCCTCTCC-3′) and EX2RV(R03) (5′-TGGATTCATGATCAGCTCTGGC-3′) were used to detect the wild-type allele, which yielded a 381 bp product. The primer set GH133 (5′-GAGTCTCGATCGAGGTCGACAT-3′) and TA-Rv1 (5′-CAGAAGGAGGTGACACCGTGGGA-3′) were used to detect the knockout allele, which gave an 832 bp product.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!