Abi prism 7000

RNAs were extracted from IPF and normal lung fibroblasts 24 h and 72 h after TGF-β1 treatment with either IFN-γ, PFD or both using RNeasy mini kits (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions. The RNAs were reverse transcribed into cDNAs, which were subjected to qPCR analyses using primer pairs specific to each of the following genes: COL1A1, ACTA2, MMP1, MMP3, MMP7, MMP8, MMP9, TIMP1, TIMP2 and YWHAZ (TaqMan™ Gene Expression Assay (FAM), Thermo-Fisher Scientific, Waltham, MA USA). qPCR was performed on an ABI Prism 7000 sequence detection system, and mRNA levels for each gene were analyzed with ABI Prism 7000 software (Applied Biosystems, Waltham, MA USA). Relative quantification of each target gene was performed using the comparative CT (2^-∆∆CT) method with YWHAZ (tyrosine 3 monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide) used as a housekeeping gene for the normalization of mRNA expression levels as reported in previous studies [36 (link), 37 ]. Data were plotted as 2^-ΔΔCT (mean fold change) using Graph Pad prism software.

The ipsilateral ischemic brain tissue and the homologous contralateral brain tissue (Figure 2A) were isolated. Total RNA was isolated and quantitative-PCR was performed in the ABI Prism 7000 sequence detection system (Thermo Fisher Scientific, Carlsbad, CA, USA), using the Quantitec SYBY Green PCR kit (Qiagen, Germantown, MD, USA). The following primers were designed using Primer Express software (ABI, Thermo Fisher Scientific, Carlsbad, CA, USA). GAPDH: Fwd, AGAACATCATCCCTGCATCC; Rev: CACATTGGGGGTAGGAACAC. MBP: Fwd, ATCCAAGTACCTGGCCACAG; Rev, CCTGTCACCGCTAAAGAAGC; ApoER2: Fwd, AGTGTCCCGATGGCTCTGAC; Rev, CAGCTTAACTTCTCGGCAGGA.
Equal amounts of brain tissue lysate were subjected to WB analysis. Specific proteins were visualized using a SuperSignal West Pico chemiluminescence kit (Pierce, Appleton, WI, USA). The following primary antibodies were used: anti-ApoER2 (1:1000, ab204112, Abcam, Cambridge, UK), anti-Syn (1:5000, MAB5258, Chemicon, Temecula, CA, USA), anti-MBP (1:500, MAB386, Millipore, Burlington, MA, USA), and anti-β-actin (1:10000; ab6276, Abcam, Cambridge, UK).

RAW cells were incubated with or without RANKL (50 ng/mL) and IL-35 (10, 50, or 100 ng/mL) for 2 days. Total RNA was isolated from cultured cells using a NucleoSpin^® RNA (Macherey-Nagel Inc., Bethlehem, PA, USA), according to the manufacturer’s instructions. cDNA was synthesized from the total RNA by the action of ReverTra Ace^® (Toyobo Co. Ltd., Osaka, Japan). TaqMan gene expression assays were used to measure MMP-9 (Mmp9:Mm00442991-m1), cathepsin K (Ctsk:Mm00484039-m1), TRAP (Acp5:Mm00437135-m1), NFATc1 (Nfatc1:Mm00479445-m1), and CLCN7 (Clcn7:Mm00442400-m1) expression using TaqMan Universal PCR master mix (Thermo Fisher Scientific, Wilmington, DE, USA). 18S rRNA (Hs99999901-s1) was used for normalization of target gene expression levels. Reactions were performed with initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min using the ABI Prism 7000 sequence detection system (Thermo Fisher Scientific). Quantification of mRNA for the target cytokine was conducted using the cycle threshold (CT) values of the target gene and 18S rRNA. The fold change in mRNA expression levels was determined as follows: 2^−ΔΔCt, where ΔΔCT = [(CT of target − CT of 18S rRNA (treated group)) − (CT of target − CT of 18S rRNA (control group))].

Real-time PCR was performed using the Taq-Man universal PCR master mix (Thermo Fisher Scientific, Massachusetts, USA) and the ABI Prism 7000 sequence detection system (Thermo Fisher Scientific, USA) (Budde et al. 2005 (link); Kanyshkova et al. 2014 (link)). The PCR program was as follows: 2 min at 50 °C, 10 min at 95 °C, 50 cycles of 15 s at 95 °C and 1 min at 60 °C. Results were analyzed with ABI Prism 7000 SDS software. Quantification was done using the comparative C_T or ΔΔC_T method as described in the ABI User Bulletin#2 (Thermo Fisher Scientific). Hybridization primer/probe assays for real-time PCR detection of hcn1, hcn2, hcn3, and hcn4 were purchased from Thermo Fisher Scientific.