Lysates were prepared in pulldown buffer (10 mM Tris pH 7.4, 50 mM NaCl, 0.5% TritonTM X-100) with protease inhibitors (10 µg/ml leupeptin, 10 µg/ml pepstatin A, 10 µg/ml chymostatin) and subsequently triturated with a 25G needle. Protein G DynabeadsTM (ThermoFisher) were prepared according to the manufacturer’s instructions. Then 100 µg of lysates or 100 ng of TDP-43 recombinant protein (NM_007375, OriGene) were incubated with 30 pmol of biotin-labelled RNA for 1 h at 4°C. Proteins were eluted with 2.5× Laemmli buffer and immediately analysed by immunoblotting with rabbit anti-TDP-43 (10789-2-AP; Proteintech) and rabbit anti-hnRNP L (156682; Abcam). Probes: positive control GRN (nt262-288): biotin- UGUGUGUGUGUGCGCGUGUGCGUGUG; negative control (AC)12: biotin-ACACACACACACACACACACACAC; G3BP1 (nt334-358): biotin-UUUUUUGUGUGUUAAUGGUGUGUG.
Rabbit anti hnrnp l
Manufactured by Abcam
Rabbit anti-hnRNP L is a primary antibody that recognizes the heterogeneous nuclear ribonucleoprotein L (hnRNP L) protein. hnRNP L is a member of the hnRNP family and plays a role in pre-mRNA processing and splicing.
Automatically generated - may contain errors
Lab products found in correlation
Protein g dynabead, by Thermo Fisher Scientific (1 mentions)
Horseradish peroxidase linked secondary anti rabbit or anti mouse igg antibodies, by Cell Signaling Technology (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Ecl kit, by Thermo Fisher Scientific (1 mentions)
Kgp250, by Keygen Biotech (1 mentions)
2 protocols using rabbit anti hnrnp l
1
TDP-43 Protein-RNA Interaction Assay
2
Western Blot Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Related cell lysates were run on 4–12% SDS PAGEs to conduct Western blot analyses. RIPA lysis buffer containing protease inhibitors (#KGP250, KeyGEN BioTECH, Nanjing, China) was used to extracted PCa cells protein following to the operation protocol. Then, equal amounts of 30 μg proteins were separated by SDS/PAGEs and transferred onto PVDF membranes (Millipore, Billerica, MA, USA) electrically. Then, membranes were blocked with TBS(Tris/saline solution with 0.1% Tween-20) including 5% milk without fat for 1 h and incubated overnight at 4 °C covering by unique antibodies: rabbit anti-β-actin (#4970, CST), rabbit anti-Slug (#9585), rabbit anti-ZEB1(#3396, CST), rabbit anti-E-Cadherin (#3195, CST) and rabbit anti-hnRNPL (4D11, #ab6106, Abcam). All membranes were subsequently incubated at room temperature for 1 h with horseradish peroxidase-linked secondary anti-rabbit or anti-mouse IgG antibodies (Cell Signaling Technology). Final bands were visualized by ECL kit (Pierce Biotechnology, Rockford, IL, USA). Image J was applied to quantify the intensity of the band. Experiments were performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!