The largest database of trusted experimental protocols

10 protocols using flavopiridol

1

Cytotoxic Compound Screening Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
E2 was obtained from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany), Flavopiridol was supplied by Cayman Chemical Company (Ann Arbor, MI, USA) and 2-ME was purchased from Selleck Chemicals (Houston, TX, USA).
+ Open protocol
+ Expand
2

Characterization of Human CCA Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human CCA cell lines, including H1 (OCUCh-LM1-H1)[9 (link)], HuCCT1[10 (link)], SSP-25[11 (link)], and ETK1[12 (link)] cell lines were kindly provided by Dr. Jack Wands. TFK-1 and RBE were purchased from RIKEN Cell Bank (Tsukuba, Japan). The non-malignant human bile duct cells hBD was purchased from Celprogen Inc (Torrance, CA, United States, Catalog Number: 36755-12). CCA cell lines were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS; GibcoTM, Thermo Scientific, Waltham, MA, United States; Cat# 10099141C), 100 μg/mL streptomycin, and 100 U/mL penicillin (HyClone™, Logan, UT, United States). The hBD cell line was grown in DMEM containing 10% FBS, 100 μg/mL strep. All cell lines were authenticated by STR and were negative for contamination of mycoplasma recently. Arcyriaflavin A, Flavopiridol, Roscovitine, and γ-secretase inhibitor, DAPT (N-[N-(3, 5-difluorophenacetyl)-l-alanyl]-s-phenylglycinet-butyl ester) were all purchased from Cayman Chemical (Ann Arbor, MI, United States).
+ Open protocol
+ Expand
3

Neutrophil Nuclear Architecture Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
In vitro differentiated neutrophils from ECOMG cells were used as a model system to study nuclear architecture in response to calcium influx in neutrophils. ECOMG cells were cultured and differentiated as previously described (Zhu et al. 2017 (link)). For inhibitors, neutrophils were treated with 10 µM Triptolide (Cayman), 100 µM 5,6-dichloro-1-β-D-ribofuranosyl-1H-benzimidazole (Cayman) or 10 µM flavopiridol (Cayman) for 30 min, or 2 µM FK506 for 2 h before activation. Primary B cells were treated with 2 µM FK506 (Cayman) for 2 h before activation. Inhibitors were kept in culture during activation time course. Acute degradation was induced by treating the cells with 0.5 µM dTAG-13 (Tocris) before activation. dTAG-13 was kept in culture during activation time course. The time series degradation experiments were performed by inducing protein degradation at the beginning of the time course and harvesting the samples at different time points. RPMI-1640 (Gibco) contains 0.42 mM calcium. Additional CaCl2 was supplied to the medium before activation to a final concentration of 1 mM. A23187 was purchased from Sigma and Cayman. Neutrophils were activated either using fast activation conditions (20 µM A23187 for 15 min), or using slow activation conditions (5 µM A23187 for 4 h). These two activation conditions were used throughout the manuscript unless otherwise mentioned.
+ Open protocol
+ Expand
4

Arabidopsis Genetic Manipulation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
The spt6l heterozygous seeds (SALK_016621), previously described (14 (link)), were obtained from the Arabidopsis Biological Resource Center (ABRC) at Ohio State University. Three formerly generated transgenic lines: ProREF6:REF6-GFP (16 (link)), ProACC1:ACC1-GFP (17 (link)) and 35S:GFP (16 (link)) were used. All Arabidopsis seeds used were in the Columbia (Col-0) background. Plants were grown either on half-strength Murashige and Skoog ( MS) medium (0.5× MS salts, 1.5% [w/v] sucrose, and 0.8% agar [pH 5.8]) or in soil under 16 h/8 h light/dark cycle at 23 °C. For the inhibitor treatment, 5,6-dichloro-1-beta-d-ribofuranosylbenzimidazole (DRB) (10010302, Cayman Chemical), flavopiridol (10009197, Cayman Chemical), or triptolide (11973, Cayman Chemical) was added to the media at a final concentration of 100, 10 and 10 μM, respectively. For the short-time treatment, 10-day-old seedlings were sprayed with 10 μM flavopiridol and grown on MS plates for 1 h. For the heat shock treatment, seeds were germinated and grown on MS plates for 7 days at 23 °C. The plates were moved to 17 °C for 3 days, after which time, the seedlings were subjected to a heat shock treatment for 1 h at 27 °C. The primers used for genotyping are listed in Supplementary Table S1.
+ Open protocol
+ Expand
5

Synthesis and Preparation of Tricin and Flavopiridol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tricin was synthesized as described previously 10, 11, and flavopiridol was purchased from Cayman Chemical (Ann Arbor, MI, USA). Both compounds were dissolved at indicated concentrations as a stock solution in DMSO and stored at −80 °C until use. The final concentration of DMSO in cell culture was adjusted 0.1%.
+ Open protocol
+ Expand
6

Multi-drug Pharmacological Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols
Doxycyclin (D9891), Doxorubicin (D1515), MG-132 (M7449), 3-Methyladenine (M9281), Chloroquine (C6628), Bafilomycin A1 (B1793), Cisplatin (1134357) and rapamycin (R8781) were purchased from Sigma-Aldrich (St Louis, MO, USA). Puromycin and Zeocin were purchased from Thermo Fisher Scientific (Grand Island, NY, USA). Cell cycle blockers, including MK-1775 (21266), Flavopiridol (10009197), Palbociclib (16273), were purchased from Cayman Chemical Company.
+ Open protocol
+ Expand
7

Comparative Analysis of Esophageal Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human esophageal cancer cell lines (OE19, OE33, ESO26, KYSE270, SK-GT-2, Flo-1, ESO51, OE21, and OACM5.1C) were obtained from Sigma Aldrich (St. Lois, MO) and cultured according to manufacturer’s instructions. Flavopiridol was obtained from Cayman Chemical (Ann Arbor, MI), nanoparticle albumin-bound paclitaxel from Goshen Center for Cancer Care (Goshen, IN), BMS-754807 from Active Biochemical Limited (Maplewood, NJ), the cell proliferation reagent WST-1 from Roche Diagnostic Corporation (Indianapolis, IN), c-Myc siRNA (sc-29226) and control siRNA (sc-37007) from Santa Cruz Biotechnology (Santa Cruz, CA). pcDNA3-cMyc was a gift from Wafik El-Deiry (Addgene plasmid #16011) (Ricci et al., 2004 (link)) and pcDNA3-EGFP as a negative control (Addgene plasmid #13031) was purchased.
+ Open protocol
+ Expand
8

Multi-drug Pharmacological Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols
Doxycyclin (D9891), Doxorubicin (D1515), MG-132 (M7449), 3-Methyladenine (M9281), Chloroquine (C6628), Bafilomycin A1 (B1793), Cisplatin (1134357) and rapamycin (R8781) were purchased from Sigma-Aldrich (St Louis, MO, USA). Puromycin and Zeocin were purchased from Thermo Fisher Scientific (Grand Island, NY, USA). Cell cycle blockers, including MK-1775 (21266), Flavopiridol (10009197), Palbociclib (16273), were purchased from Cayman Chemical Company.
+ Open protocol
+ Expand
9

Endogenous NELF-C and NELF-E Tagging

Check if the same lab product or an alternative is used in the 5 most similar protocols
For homozygous mAID tagging to the endogenous NELF-C gene, donor plasmids YNP37 (NELF-C-AID_Neo) and YNP38 (NELF-C-AID_Hyg) were prepared using pMK286 and pMK287 (Natsume et al., 2016 (link)). Cas9 plasmid YNP39 (gRNA: CTGCAAATCTAACTTCATCA) was prepared using pX330 (Cong et al., 2013 (link)). Similarly, for NELF-E gene tagging, donor plasmid YNP47 (NELF-E-AID_Neo) and YNP48 (NELF-E-AID_Hyg) and Cas9 plasmid YNP41 (gRNA: CTACAGTGATGACGTCTACA) were prepared. Compounds for cell treatment: 1 M stock solution of Auxin (3-indole-acetic acid sodium salt, abcam) was prepared in H2O and added in culture at 500 μM. 1 mM stock solution of Flavopiridol (Cayman) was prepared in DMSO and added in culture at 1 μM. 1 mM stock solution of NVP-2 (MedChemExpress) was prepared in DMSO and added in culture at 250 nM.
+ Open protocol
+ Expand
10

Apoptosis Analysis in Mouse Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine 2000 reagent (Invitrogen, 11,668,027) was purchased for transient transfection in neuronal cells according to the manufacturer’s instructions. Rnase (AM2286, Invitrogen) and Dnase (D4513, Sigma) treatments were performed according to the manufacturer’s instructions. Cresyl violet acetate (C5042, Sigma) 2.5% aqueous is used in Nissl staining of mouse brain sections. Actinomycin D (A1410, Sigma), N-Acetyl Cysteine (NAC, A7250, Sigma), flavopiridol (10,009,197, Cayman) and rhein (17,345, Cayman) were purchased and used in the treatment of primary neurons as indicated. In Situ Cell Death Detection Kit (11,684,795,910, Roche) was used to label rehydrated mouse brain sections undergoing apoptosis following manufacturer’s instructions in this study. This method is based on labeling of DNA strand breaks (TUNEL technology) and analyzed by fluorescence microscopy. After TUNEL labeling, the sections were stained for GFP using Alexa Fluor 568 goat anti-mouse secondary antibody (A-11004, Invitrogen) and FITC-labelled cells were imaged on Leica HyVolution SP8 confocal microscope.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!