Evenly draw least 3 cross lines with marker pen about every 1cm at the back of the 6-well plate. One day before transfection, equal numbers of NPC cells (6X10⁶) were seeded into 6-well plates. Cells were then transfected with 50nM siMYH10 using riboFECT (Ribobio, Guangzhou, China). At around 24h post-transfection, a wound was made perpendicular to the draw lines on cell layer with the use of a sterile plastic 200ul micropipette tip. After wounding, cells were cultured with 2% FBS medium. At different time points, cells that migrated into the wounded area or cells with extended protrusion from the border of wound were photographed under an inverted microscope.
Ribofect
Manufactured by RiboBio
Sourced in China
RiboFECT is a transfection reagent designed for delivering RNA molecules, such as small interfering RNAs (siRNAs) and microRNAs (miRNAs), into mammalian cells. It facilitates the efficient uptake and intracellular delivery of these RNA molecules, enabling gene silencing and other RNA-based applications.
Automatically generated - may contain errors
Lab products found in correlation
Nc sirna, by RiboBio (1 mentions)
Hu6 mcs cbh gcgfp ires puromycin, by Genechem (1 mentions)
Puromycin, by Santa Cruz Biotechnology (1 mentions)
Si control, by RiboBio (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Merck Group (1 mentions)
Si h19, by RiboBio (1 mentions)
Mir 130a 3p mimic, by RiboBio (1 mentions)
Dual glo luciferase assay system, by Promega (1 mentions)
12 protocols using ribofect
1
Wound Healing Assay with siMYH10
2
Transfection of miR-200 family in NPC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siMYH10 and the Negative Control was designed and synthesized by Guangzhou Ribobio company, cells were plated into six-well plates (1×10 6 cell/well) and transfected with siMYH10 using riboFECT (Ribobio, Guangzhou, China) according to the manufacturer's protocol.The miR-200 family mimic and miR-200a inhibitor primer, which were synthesized by Ribobio(Guangzhou, China), was transfected to NPC cells in the same way.
3
Knockdown of LOX-1 in Gastric Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LOX-1 siRNA and a non-specific control siRNA (NCsiRNA) were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). siLOX-1-1, sense, 5′-AGGACG GUUCUCCUUUGAUdTdT-3′, and anti-sense, 3′-dTdTUCCU GCCAAGAGGAAACUA-5′; siLOX-1-2, sense, 5′-CAGGUA CCUGUGCAUAUAUdTdT3′, and antisense, 3′-dTdTGUCCA UGGACACGUAUAUA-5′; and siLOX-1-3, sense, 5′-CGAACU CAAGGAAAUGAUAdTdT-3′, and antisense, 3′-dTdTGCUU GAGUUCCUUUACUAU-5′.
Transfection was performed according to the manufacturer’s protocols of the interference kit (Guangzhou RiboBio Co., Ltd.). When HGC-27 gastric cancer cells were grown to ~60% confluency, riboFECT (Guangzhou RiboBio Co., Ltd.) was used for transfection. For each transfection reaction, transfection complexes were prepared at room temperature using 20 nM siLOX-1 or NCsiRNA, incubated at 37°C for 10 min and then added to the serum-free DMEM. RNA and proteins were collected 24 h after transfection and the effect of interference was determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) or western blot analysis, as aforementioned. Cells were used for other experiments 24-72 h after transfection.
Transfection was performed according to the manufacturer’s protocols of the interference kit (Guangzhou RiboBio Co., Ltd.). When HGC-27 gastric cancer cells were grown to ~60% confluency, riboFECT (Guangzhou RiboBio Co., Ltd.) was used for transfection. For each transfection reaction, transfection complexes were prepared at room temperature using 20 nM siLOX-1 or NCsiRNA, incubated at 37°C for 10 min and then added to the serum-free DMEM. RNA and proteins were collected 24 h after transfection and the effect of interference was determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) or western blot analysis, as aforementioned. Cells were used for other experiments 24-72 h after transfection.
4
CD44v10 Knockdown and Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA constructs targeting human CD44v10 (NM_001202555) expression were designed and synthesized by RiboBio company (Guangzhou, China), and transfection was performed with riboFECT according to the manufacturer’s protocol. Sequences for siRNA knockdown, including CD44v10 siRNA (5′-CUACUUUACUGGAAGG UUA-3′), GLUT1 siRNA (5′-CUGUGGGCCUUUUCGUUAA-3′), and the scramble negative control siRNA sequence was 5′-UUCUCCGAACGUGUCACGU-3’. CD44v10 siRNA construct was inserted into the lentiviral vector hU6-MCS-CBh-gcGFP-IRES-puromycin (Genechem Company) for lentivirus production. Human CD44v10 was constructed by PCR-based amplification and cloned into the Ubi-MCS-3FLAG-SV40-Cherry-IRES-puromycin vector system (Genechem Company). Cells were infected with concentrated lentivirus according to the manufacturer’s instructions and treated with puromycin (2 μg/ml; Santa Cruz Biotechnology) for 3 weeks to generate stable CD44v10-knockdown or CD44v10-overexpression cells. The knockdown efficiencies and stable overexpression were verified by Western blotting assay.
5
Silencing UPF1 Gene in EEC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiRNA against UPF1 gene and corresponding scrambled siRNA (NC) were synthesized by RiboBio (Guangzhou, China). They were transfected into EEC Cells using riboFECT™ (Ribobio, Guangzhou, China) according to the manufacturer’s instructions. The following siRNA target sequences were used: siUPF1-1, GATGCAGTTCCGCTCCATT; siUPF1-2, CCCAGACTCAAGATAACAT; siUPF1-3, GAGAATCGCCTACTTCACT. We chose one of them for relatively higher interference efficiency. The negative control siRNA sequences were as previously reported.
6
HNSCC Cell Line Culture & Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HNSCC cell lines Fadu, SCC-4, Cal-27, and Tu686 were purchased from the Hunan Fenghui Biotechnology Co., Ltd. Fadu and Cal-27 cells were cultured in DMEM medium (BI, Israel) with 8% fetal bovine serum (FBS). SCC-4 cells were cultured in RPMI-1640 medium (BI, Israel) with 8% FBS. Tu686 cells were cultured in DMEM: F12 (1:1) medium (BI, Israel) with 8% FBS. All cells were cultured in medium supplemented with 1% PenStrep (100 U/ml penicillin and 100 μg/ml streptomycin) at 37°C in an atmosphere of 5% CO2. SERPINE1 siRNA, miR-181c-5p mimic, and inhibitor (RiboBio, Guangzhou, China) were transfected using riboFECT (RiboBio, Guangzhou, China).
7
CD44 Variant Knockdown in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of CD44 variants was knocked down using corresponding siRNAs. A series of siRNA oligonucleotides including sicontrol, siCD44v3, siCD44v4, siCD44v5, siCD44v6, siCD44v7, siCD44v8, siCD44v9 and siCD44v10 were designed and synthesized by Guangzhou RiboBio Co., Ltd. The CD44v2 exon was excluded in current study due to its considerably low expression in BCa cells (27 (link)). The siRNA oligonucleotides are listed in Table SI . The MDA-MB-231 and BT-549 cells were separately seeded in 6-well plates at 3×105/well and transfected with siRNA for 48 h at 37°C using riboFECT™ (Guangzhou RiboBio Co., Ltd.), according to the manufacturer's protocol, and 50 nM siRNAs. Reverse transcription-quantitative (RT-q)PCR was performed to verify the transfection efficacy after 48 h, and cells were either used for in vitro experiments or lysed for western blot analysis.
8
Plasmid Transfection and miRNA Modulation in EEC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reporter promoter or interference plasmids of PTEN and PTENP1 were synthesized by Yingxin (Guangzhou, China) and named pcDNA3.1-PTEN, pcDNA3.1-PTENP1, RNAi-PTEN, RNAi-PTENP1. Meanwhile, their empty vector, pcDNA3.1(+) and pCDH-CMV-MCS-EF1-copGFP-T2A-Puro were separately used as the control plasmid. Ten micrograms of the PTEN or PTENP1 vector was transfected into EEC cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer's instructions.
The miR-200c mimic and inhibitor primer (Supplementary Table1 ), which were synthesized by Ribobio (Guangzhou, China), was transfected to ECC cells using riboFECT™ (Ribobio, Guangzhou, China) according to the manufacturer’s instructions.
The miR-200c mimic and inhibitor primer (Supplementary Table
9
miR-146a Regulation of Trophoblast Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human trophoblast cell line HTR-8/SV neo cells were cultured in RPMI 1640 media with 10% FBS and 1% P/S. Cells at 40-50% confluence were transfected with miR-146a (sence: 5′UGAGAACUGAAUUCCAUGGUU3′, anti-sence:5′CCCAUGGAAUUCAGUUCUCAUU3′) or mimic(sence:5′UUCUCCGAACGUGUCACGUTT3′,anti-sence:5′ACGUGACACGUUCGGAGAATT3′) by riboFECT (Guangzhou RiboBio, China) according to manufacturer's instruction. After 24 hrs of transfection, total RNA was isolated. qPCR was used to examine miR-146a levels and its target mRNAs eg. IRAK1 and TRAF6. After 48 hrs of transfection, cell lysates and culture media were collected to quantify protein levels.
10
Modulating tPA and LRP1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The small interference RNA (siRNA) constructs targeting human tPA and human LRP1 expression were designed and synthesized by RiboBio company (Guangzhou, China), and the transfection was performed with riboFECTTM according to the manufacturer’s protocol. The siRNA sequences were listed as follows: tissue type plasminogen activator (tPA) siRNA (5′-CCCUCUCUUCAUUGCAUCCAU-3′), LRP1 siRNA (5′- GCUCAUCUCGGGCAUGAUU-3′), and scramble negative control siRNA (5′-UUCUCCGAACGUGUCACGU-3′). The human CD44s (NM_001001391) was constructed by PCR-based amplification and then cloned into the Ubi-MCS-SV40-IRES-puromycin vector system (Genechem Company, Shanghai, China). Next, cells were infected with concentrated lentivirus according to the manufacturer’s instructions and after infection, puromycin (2 μg/mL, Sigma Aldrich, St. Louis, MO) was used to select stably transduced cells over a 15-day period. Finally, the overexpression efficiency was verified by western blotting assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!