Herculase 2 fusion dna polymerase

Genomic DNA from sorted cells were extracted using the QIAGEN DNeasy Blood & Tissue Kits following the manufacturer’s protocol, with the exception of DNA elution in water instead of buffer AE. sgRNA-insert was first PCR-amplified using Herculase II Fusion DNA polymerase (Agilent) with primers (Forward) AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and (Reverse) CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC, using up to 2 μg genomic DNA per 50 μl reaction. Equal volumes from each reaction were pooled and used for a further PCR amplification step to attach Illumina sequencing adaptors and Illumina P7 barcodes, using Herculase II Fusion DNA polymerase. The 330 bp library was gel purified and quantified using KAPA library quantification kit (Roche). Libraries were pooled and sequenced with a HiSeq 4000 at the CRUK Cambridge NGS facility.

Genomic DNA was isolated using QiaAmp DNA Blood Maxi or QiaAmp DNA mini kits (Qiagen) according to the manufacturer’s instructions, genomic DNA was then amplified using Herculase II polymerase (Agilent) as described previously (Deans et al., 2016 (link)). To prepare the sgRNA sequencing library, the integrated sgRNA-encoding constructs were PCR amplified using Agilent Herculase II Fusion DNA Polymerase, followed by a second PCR amplification introducing sample-specific Illumina index barcodes and adapters for deep sequencing. Deep sequencing was performed using the MiSeq Reagent Kit v2 (300 cycles; Illumina) employing a custom sequencing oligo according to the manufacturer’s instructions:
(5’-GCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCTTAGCTCTTAAAC-3’).

Genomic DNA from sorted cells were extracted using the QIAGEN DNeasy Blood & Tissue Kits following the manufacturer’s protocol, with the exception of DNA elution in water instead of buffer AE. sgRNA-insert was first PCR-amplified using Herculase II Fusion DNA polymerase (Agilent) with primers (Forward) AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and (Reverse) CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC, using up to 2 mg genomic DNA per 50 μl reaction. Equal volumes from each reaction were pooled and used for a further PCR amplification step to attach Illumina sequencing adaptors and Illumina P7 barcodes, using Herculase II Fusion DNA polymerase. The 330 bp library was gel purified and quantified using KAPA library quantification kit (Roche). Libraries were pooled and sequenced with a HiSeq 4000 at the CRUK Cambridge NGS facility.