The largest database of trusted experimental protocols

Sybr green premix pro taq hs qrt pcr kit

Manufactured by Accurate Biology
Sourced in Switzerland, China

The SYBR Green premix pro Taq HS qRT-PCR kit is a reagent used for quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) assays. It contains a proprietary hot-start DNA polymerase, SYBR Green I dye, and other necessary components for performing qRT-PCR experiments.

Automatically generated - may contain errors

4 protocols using sybr green premix pro taq hs qrt pcr kit

1

Quantifying Gene Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HiPure RNA Mini Kit (Magen, Guangzhou, China) was used to isolate total RNA following the manufacturer’s instructions. Primer pairs for quantitative real-time PCR (qRT-PCR) were designed using Primer3 (Untergasser et al., 2012 (link)) (Supplementary Table S1). First-strand cDNA was synthesized using the Hiscript QRT SuperMix (with gDNA Wiper; Vazyme, Nanjing, China). qRT-PCR was conducted on a LightCycler 480 real-time PCR system (Roche, Basel, Switzerland) using the SYBR ® Green Premix Pro Taq HS qRT-PCR Kit (Accurate Biotechnology, AG11718, Hunan, China). The PCR protocol was described by (Ou et al., 2022 (link)). The comparative 2-ΔΔCT method was used to calculate relative expression values for each gene (Livak and Schmittgen, 2001 (link)).
+ Open protocol
+ Expand
2

Serum RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from 200 μl of serum using Trizol reagent (Sigma, USA), and then, RNA was reverse transcribed into cDNA with a high-capacity cDNA reverse transcription kit (Takara). Quantitative real-time PCR (qRT-PCR) analyses were performed by SYBR Green premix pro Taq HS qRT-PCR kit (Accurate Biotechnology (Hunan) Co., Ltd) to validate gene expression, and the level of β-Actin served as an internal control. The relative expression of the target gene was calculated and normalized to the expression of the reference gene β-Actin. The primers’ sequences for qRT-PCR are shown in Supplementary Table 1.
+ Open protocol
+ Expand
3

Quantitative Real-Time PCR Analysis of Prognostic Genes in HCC

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissue samples using Trizol reagent (Sigma, USA), and then, RNA was reverse transcribed into cDNA with the Evo M-MLV RT Premix (Accurate Biotechnology (Hunan) Co.,Ltd). Quantitative real-time PCR (qRT-PCR) analyses were performed by SYBR Green premix pro Taq HS qRT-PCR kit (Accurate Biotechnology (Hunan) Co.,Ltd) to validate gene expression, and the level of β-Actin served as an internal control. The relative expression was calculated based on the comparative Ct (2−ΔΔCt) method. The primers’ sequences for qRT-PCR are shown in Table 2. The protein expression levels of 6 prognostic gene signatures in normal liver and HCC tissues were determined using the Human Protein Atlas (HPA).

The primer sequences for qRT-PCR analysis

PremierSequences (5′–3′)
β-Actin-FCTCCATCCTGGCCTCGCTGT
β-Actin-RGCTGTCACCTTCACCGTTCC
TNFSF4-FCCCTGGGACCTTTGCCTATT
TNFSF4-RGGGGTTGGACCCTTTCCATC
TNFRSF4-FAAGCCTGGAGTTGACTGTGC
TNFRSF4-RCCTGTCCTCACAGATTGCGT
TNFRSF11A-FGTTGCAGCTCAACAAGGACAC
TNFRSF11A-RCAGAGAAGAACTGCAAACCGC
TNFRSF11B-FCTGGAACCCCAGAGCGAAAT
TNFRSF11B-RGCCTCCTCACACAGGGTAAC
TMIGD2-FAGAACAGAAACCGGATCGCA
TMIGD2-RGGCTGTTACCTGAGTCCCTT
CD40LG-FATGGGAAACAGCTGACCGTT
CD40LG-RGATTGTTGCCCGCAAGGTTT
+ Open protocol
+ Expand
4

Quantitative RT-PCR Analysis of Plant RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the EASYspin Plus Complex Plant RNA Kit (RA53, Aibosen Biology, Beijing, China), and it was detected by agarose gel electrophoresis. First-strand cDNA was synthesized according to the instructions of the Evo M-MLV RT Mix Kit with gDNA Clean for qRT-PCR (AG11728, Accurate Biology, Hunan, China). Finally, using the SYBR Green Premix Pro Taq HS qRT-PCR Kit (AG11701, Accurate Biology, Hunan, China) [33 (link)], qRT-PCR detection was performed on a CFX ConnectTM Real-Time PCR Detection System (PXF2080, Bio-Rad, CA, USA). Spβ-actin was used as an internal reference gene, and the primer sequences are listed in Table S1. The quantitative results were analyzed using the 2−ΔΔCT method [39 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!