The largest database of trusted experimental protocols

Hiscript rt supermix for qpcr gdna wiper kit

Manufactured by Vazyme
Sourced in China

The HiScript RT SuperMix for qPCR (+gDNA wiper) Kit is a reverse transcription kit designed for real-time quantitative PCR (qPCR) applications. The kit includes a reverse transcriptase enzyme and a DNA wiper component to remove genomic DNA contamination.

Automatically generated - may contain errors

2 protocols using hiscript rt supermix for qpcr gdna wiper kit

1

RT-qPCR Analysis of Salmonella Enteritidis Stress Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RT-qPCR test was carried out to quantify gene expression levels [28 (link),29 (link)]. The TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA) was utilized to extract total RNA from S. Enteritidis cells cultured as described in Section 2.3. The cDNA was then synthesized using a HiScript RT SuperMix for qPCR (+gDNA wiper) Kit (Vazyme Biotech Co., Ltd., Nanjing, China). Primers in Table 1 were referenced from published data [14 (link),15 (link)]. PCR amplification was initiated at 95 °C for 5 min, followed by 40 cycles at 95 °C for 5 s, 55 °C for 15 s, and 68 °C for 30 s. Change in gene expression levels of S. Enteritidis under ethanol stress was compared with that in pure TSB-YE with 16S rRNA as the reference gene by the 2−ΔΔCt method [30 (link)].
+ Open protocol
+ Expand
2

Quantitative PCR Analysis of CXCL11 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For cDNA synthesis, 1 μg total RNA was processed using the HiScript RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme). The ChamQ Universal SYBR qPCR Master Mix (Vazyme) was used for the thermocycling reaction. The RT‐qPCR analysis was carried out in triplicate times. Primer sequences were as follows:

Beta‐ACTIN: Forward: 5′‐GTGGCCGAGGACTTTGATTG‐3′,

Reverse: 5′‐CCTGTAACAACGCATCTCATATT‐3′,

CXCL11: Forward: 5′‐GACGCTGTCTTTGCATAGGC‐3′,

Reverse: 5′‐GGATTTAGGCATCGTTGTCCTTT‐3′.

+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!