Hiscript iiq rt supermix for qpcr gdna wiper kit

Total RNA extraction was carried out using the TransZol kit (TransGen Biotech, Inc., Beijing, China). cDNA reverse transcription refers to use of the HiScript^®IIQ RT SuperMix for qPCR (+gDNA wiper) vazyme kit (Vazyme, Piscataway, NJ, United States). quantitative polymerase chain reaction (qRT-PCR) was carried out in LightCycle ^∗ 96 Real-Time PCR System (Roche, Basel, Switzerland) with 25 μL reaction system. Three biological repeats and three technical repeats were used to calculate the relative quantification according to the Ct values collected by the instrument. The formula is: 2^−△△Ct =  2^{−[(Target gene control Ct−Target gene sample Ct)−(Reference gene control Ct−Reference gene sample Ct)]}. The actin gene Capana04g001698 was used as reference gene which was selected from pepper. The primers of six CaR2R3-MYB DEGs and four CBGs were developed by GenScript Real-time PCR (TaqMan) Primer and Probes Design Tool⁶, which were listed in Supplementary Table 3.

The HiScript^®IIQ RT SuperMix for qPCR (+gDNA wiper) vazyme kit (Vazyme, Piscataway, NJ, United States) was utilized with a 50 µL reaction system to complete three biological and three technical replicates for each sample. The LsGRAS13 gene was cloned from lettuce cDNA, subjected to restriction through double enzyme digestion, and its fragment was amplified by using PCR. Simultaneously, the TRV2 vector (35 s promoter) underwent double enzyme digestion with EcoRI (GATTCTGTGAGTAAGGTTACCG) and BamHI (GAGACGCGTGAGCTCGGTACCG). The PCR primers used were LsGRAS13-F: CTTCGGATTGGAGGTCTGATGTGG and LsGRAS13-R: TGAACAGAATCGGAGGCAAGTTGAG. The recovered PCR product was then ligated with the vector to produce the recombinant plasmid. The identified recombinant plasmid was then transformed into Agrobacterium GV3101, and the infection solution was prepared. The infection buffer comprised 10 mM magnesium chloride, 10 mM MES buffer, and 20 mM acetylsyringone (MMA) [4 (link)]. The experiment was categorized into three groups: a blank control group (WT), a negative control group (TRV2-TRV1), and an experimental group (TRV2-LsGRAS13).

The total RNA was reverse-transcribed according to the instructions of the HiScript^®ⅡQ RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme Biotech, Nanjing, China). The reaction system has two steps as follows: the first step was performed in a total of 20 μL reaction by using 4×gDNA wiper mix 4 μL, with a total RNA 4 μL and RNase free ddH₂O 12 μL, incubated at 42 °C for 2 min; the second step was performed by adding 4 μL 5×HiScript^® II qRT SuperMix II^a and 16 μL. The first step of the reaction was conducted at 50 °C for 15 min, then 85 °C for 5 s, and the product of cDNA was stored at −20 °C.