Pegfp c1 mammalian expression vector

Previously cloned (14 (link)) human full-length TopBP1 coding sequence (CDS, Uniprot Q92547) was ligated into pEGFP-C1 mammalian expression vector (BD Biosciences, Genbank #U55763). Mutated TopBP1 in pEGFP-C1 was generated by introducing a tryptophan (W) to arginine (R) mutation at amino acid 1145 of TopBP1 using overlap extension polymerase chain reaction (PCR). For the preparation of stable Tet-On Advanced cell lines, the whole CDS of eGFP-TopBP1 WT or eGFP-TopBP1 W1145R was ligated to the pTRE-Tight vector (Clontech). TopBP1 deletion mutants were prepared and ligated into pEGFP-C1 vector using In-Fusion HD EcoDry Cloning Kit (Clontech). The correct sequences of all constructs were verified by sequencing (ABI Prism 310 Genetic Analyzer). DNA transfections were done with Effectene (Qiagen) transfection reagent.
Stable doxycycline-inducible U2OS cell lines were generated using Tet-On Advanced gene expression system (Clontech). Cells were designed to express either wild-type (WT) or W1145R mutant of human TopBP1 N-terminally fused to Enhanced Green Fluorescent Protein (eGFP).

The plasmid pBSK(+)-DnaJC18 harboring the cDNA of rat DnaJC18was used as the PCR template to construct the GFP-DnajC18 fusion protein
plasmid. The entire coding region of rat DnaJC18 cDNA was amplified with a
forward primer containing the added EcoRI site at the upstream
of the start codon (5’ TAGAATTCTATGGCGGCCACTCTG GGC 3’)
and a reverse primer including the SalI site at downstream of
stop codon (5’ TAGTCGACTCAGCCGGC CCTGCGGAG 3’). The PCR
products were digested with EcoRI/ SalI and inserted in frame
into the EcoRI and SalI site of pEGFP-C1
mammalian expression vector (BD Clontech, CA, USA). The GFP-DnaJC18 constructs
(pEGFP-DJC-5) was confirmed by DNA sequencing.