The largest database of trusted experimental protocols

Specific stem loop reverse transcription rt primers

Manufactured by Thermo Fisher Scientific
Sourced in United States

Specific stem-loop reverse-transcription RT primers are molecular biology tools used for the quantification of microRNAs (miRNAs) and other small RNA targets. These primers enable efficient and specific reverse transcription of target RNAs for downstream quantitative PCR (qPCR) analysis.

Automatically generated - may contain errors

2 protocols using specific stem loop reverse transcription rt primers

1

Zebrafish miRNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
For miRNA analysis, zebrafish blood was obtained by RO technique and pooled as described in results. Serum was separated by centrifugation and miRNA was extracted using a miRNeasy kit (Qiagen, Venlo, Netherlands) after which the small RNA fraction was purified using a MinElute kit (Qiagen, Venlo, Netherlands).8 (link) MiRNAs were measured using Taqman-based quantitative PCR.
The small RNA elute was reverse transcribed using specific stem-loop reverse-transcription RT primers (Applied Biosystems, Foster City, CA, USA) for each target miRNA species, following the manufacturer’s instructions. In the reverse transcription reaction, 2 μl of RNA was used to produce the complementary DNA (cDNA) template in a total volume of 15 μl. Then, 1.33 μl of cDNA was used in the PCR mixture with specific PCR primers (Applied Biosystems, Foster City, CA) in a total volume of 20 μl. Levels of miRNA were measured using the Light Cycler 480 (Roche, Basel, Switzerland). All samples were assayed in duplicate. MiRNA levels were normalised to levels of let-7d which has been reported to be an appropriate internal normaliser in humans.20 (link) At the time of writing the optimum normaliser for zebrafish was not described.
+ Open protocol
+ Expand
2

Plasma Biomarker Measurement Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Laboratory analyses of all biomarkers were carried out blinded to participant clinical data. Analysis of miR-122 was carried out in the Centre for Cardiovascular Sciences, University of Edinburgh); HMGB1, flk-18 and cck-18 laboratory analyses were carried out at the MRC Centre for Drug Safety Science, University of Liverpool.
miR was extracted from plasma using the miRNeasy Serum/Plasma Kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s protocol.17 18 Synthetic miR-39 (at 1.6×108 copies/µL) was spiked in as an internal control. miRs were measured with Taqman-based quantitative PCR. Small RNA elutes were reverse transcribed using specific stem-loop reverse-transcription RT primers (Applied Biosystems, Foster City, California, USA) for each target miR species, following the manufacturer’s instructions. Specific stemloop rt primer targeting UGGAGUGUGACAAUGGUGUUUG and 5’ UCACCGGGUGUAAAUCAGCUUG 3’ was used. No template controls were included to test for miR contamination. The expressions of miR-39 and miR-122 were analysed using the standard 2-dct method19 (link) normalised to the miR-39 spiked internal control.
Plasma HMGB1 and keratin-18 were determined by ELISA according to the manufacturer’s guidelines (Shino-Test/IBL International20 21 for HMGB1; and PEVIVA22 for cck-18 and flk-18) and our previously published protocols.5 23 (link)
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!