Buccal cells were collected via cotton swabs that were rubbed at oral mucosa and then washed out in an alcoholic solution. This solution was concentrated afterward, e.g., by means of centrifugation, and later used for DNA extraction. Genomic DNA was extracted automatically from buccal cells using the MagNA Pure 96 System and a commercial extraction kit (MagNA Pure 96 DNA Kit; Roche Diagnostics, Mannheim, Germany). Genotyping of the SNP rs2572431 was performed by a collaborating company (Varionostic, Ulm, Germany) using MassARRAY® technology (Agena Bioscience, Hamburg, Germany).
Massarray technology
Manufactured by Agena
Sourced in United States
The MassARRAY technology is a mass spectrometry-based platform designed for high-throughput and multiplexed genetic analysis. It provides a sensitive and accurate method for detecting and quantifying genetic variations, such as single nucleotide polymorphisms (SNPs), insertions, and deletions. The core function of the MassARRAY system is to generate and analyze mass spectra of DNA fragments, which can be used to determine the genetic composition of a sample.
Automatically generated - may contain errors
Lab products found in correlation
Compact spectrometer, by Agena (2 mentions)
Wizard genomic dna purification kit, by Promega (2 mentions)
Iplex gold chemistry, by Agena (2 mentions)
Quantifluor dsdna system, by Promega (2 mentions)
Magna pure 96 dna kit, by Roche (1 mentions)
Magna pure 96 system, by Roche (1 mentions)
Spss version 21, by IBM (1 mentions)
Dna extraction kit, by Tiangen Biotech (1 mentions)
Massarray platform, by Agena (1 mentions)
7 protocols using massarray technology
1
Buccal Cell DNA Extraction and Genotyping
2
Genotyping Polymorphisms via MALDI-TOF Mass Spectrometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were isolated by the conventional phenol–chloroform phase separation method. The coded samples were blinded and genotyped through a commercial facility (Genes2Me: https://www.genes2me.com ) using Agena MassARRAY technology, which is based on matrix-assisted laser desorption/ionization—time of flight (MALDI-TOF) mass spectrometry. Genetic polymorphisms are distinguished by analysis of their individual mass, excluding the need for fluorescence or labelling. Control samples, duplicates, negatives and positives were used for quality control. Out of 35 SNPs, two failed in assay design and ten SNPs (rs6763159; rs11894932; rs365990; rs17189763; rs2010963; rs350916; rs436582; rs4366490; rs8061121; rs870142) gave ambiguous reads on QC and were removed from the analysis. Only 23 markers and samples which had > 80% genotype calls were retained in the study. A chi-square test was used for association measures and Fisher’s exact test was used, if the expected number was less than five. Statistical tools like SPSS version 21.0 and free online tools [45 ] (https://vassarstats.net/ ) were used for analysis. Power was calculated using Quanto [46 ] (http://biostats.usc.edu/Quanto.html ).
3
Breast Cancer Genetic Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from all samples using the Promega Wizard® Genomic DNA purification kit according to the manufacturers’ protocol. The DNA samples were quantified using the Promega QuantiFluor® dsDNA System and normalized to 10.0 ng/μl. All the samples were genotyped for the selected tagged SNPs in the breast cancer candidate genes using the Agena Bioscience Mass-Array technology on a Compact Spectrometer, iPLEX GOLD chemistry (Australian Genome Research Facility, Gehrmann Laboratories, University of Queensland). MassArray Designer software was used for designing primers flanking the gene region containing the SNPs. Altogether, 57 SNPs were successfully genotyped, and the average SNP call rate was 99.87% in both cases and controls. Among them, SNP rs1047111 deviated from Hardy-Weinberg equilibrium test with a P-value < 0.05 and was excluded from analysis. A total of 697 subjects, comprising of 349 cases and 348 controls passed filters and quality control.
4
Pharmacogenomic Profiling for Transplant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Before the transplant, a 2 mL of the patient’s peripheral venous blood was taken, and genomic DNA was extracted using a DNA extraction kit (TIANGEN, Beijing, China). The ABCB1 (rs1045642, rs3842, rs1128503, rs34800935), CYP3A4 rs2242480, CYP3A5 rs776746, POR rs17685 and NR1I3 rs2307424 genotypes were determined using the Agena Bioscience MassARRAY technology. Hardy-Weinberg equilibrium testing is performed using a χ2 goodness-of-fit (GOF) test.
5
GALC Variant Genotyping Across Canine Breeds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate if the identified variant of interest was private to this cohort or found in other breeds, 278 dogs from 5 breeds (Collie n = 45, Doberman n = 46, Italian Greyhound n = 45, Scotch Collie n = 45, Border Collie n = 97) were also genotyped for the GALC variant by MassARRAY technology (Agena Bioscience, Inc., San Diego, California, USA). Breeds were selected based on the breed assignment analysis. Primers were designed using the MassARRAY Typer Assay Design software v5.0.1 (5′ Capture Primer: ACGTTGGATGTGTTGTGTGGTGTGCATCAG, 3′ Capture Primer: ACGTTGGATGTTGAGAACGATAGGGCTCTG, Extend Primer: AGAAGTCGGGAGGTT). Samples were amplified using iPLEX Gold Reagents, and dogs with genotypes confirmed by Sanger sequencing were used as positive controls for each possible genotype (G/G, G/A, A/A). Data were analyzed using the TyperAnalyzer v5.0.2 (Agena Bioscience, Inc., San Diego, California, USA).
6
SNP Genotyping in DNA Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction from all samples was performed using the Promega Wizard® Genomic DNA purification kit (Promega, Madison, USA) according to the manufacturers' protocol. The Promega QuantiFluor® dsDNA System (Promega) was used to quantify and normalize the samples to a concentration of 10.0 ng/µL. Genotyping of all the samples for the selected set of SNPs was performed using the Agena Bioscience Mass-Array technology on a Compact Spectrometer, iPLEX GOLD chemistry (Australian Genome Research Facility, Gehrmann Laboratories, University of Queensland, Brisbane, Australia). Primers flanking the gene regions containing the target SNPs were designed using MassArray Designer software [5 (link)]. A total of 57 SNPs was successfully genotyped with an average SNP call rate of 99.87%. SNP rs1047111 was excluded from analysis because the allele frequencies deviated from Hardy-Weinberg equilibrium at p-value <0.05. One sample was excluded, and a total of 349 cases passed filters and quality control.
7
Genotyping Panel of Single Nucleotide Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A panel comprising 120 positive sites identified by Sanger sequencing were selected. These single nucleotide polymorphisms were located within genes of different functional categories. For the PCR amplification and single base extension reaction, primer pairs and extension primers were designed using Assay design suite v2.0. These primers were multiplexed and genotyped using the Sequenom MassARRAY platform integrating the iPLEXSBE reaction and MassARRAY technology (Agena Bioscience, San Diego, CA, USA) based on the MALDI-TOF MS assay [16 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!