Superscript 2

Comparisons between qPCR and RNA-Seq were performed using four replicates from each treatment at pre-dawn (drought and control) and mid-day (drought, control, and recovery) sampling points on day 14 (n = 20 samples). Oligo-dT primed (dT₂₀) first-strand cDNA was prepared for each sample using 500 ng total RNA and Superscript II reverse transcriptase (Clontech, Mountain View, CA, USA), then used for duplicate qPCR reactions for each sample and target. RT-qPCR was conducted with SYBR Green PCR Master Mix (Invitrogen, Carlsbad, CA, USA) using a 7300 Real-Time PCR System (Applied Biosystems). Primer efficiency was verified using a cDNA dilution series (100% ± 5%) and specificity by melt curve analysis. Stable expression of reference genes was verified based on replicate samples (n = 4 from each group) with equal amounts of total RNA in each reaction analyzed using the 2^-ΔCt method, and expression values normalized to the average C_t of three stable reference genes (CoxI, CyCTI-3, and Eif5a) using the ddC_T method [52 (link)].

The protocols for the generation of cDNA from single cells, microarray hybridisation and the statistical analysis of array results have been published in detail previously25 (link).
To generate 1^st strand templates for the testing of splice forms, we dissected 10 embryonic and 5 larval CNSs from each genotype and harvested the RNA using the GenElute Mammalian Total RNA Kit (Sigma). Samples were analysed by reverse transcribing total RNA from larval CNSs using Superscript II (Clontech) and primers from the Smarter PCR cDNA synthesis kit (Clontech). We tested for the presence or absence of the splice product by amplification through 35 PCR cycles. For every PCR we used 100 ng of 1^st strand cDNA as templates. All RT PCRs were repeated twice using freshly dissected CNSs as RNA source. The primers used are: Cha Intron 2 forward CCAAAGAAATGGCTCTCAACG, Cha Intron 2 reverse CAGCAGATACTGATGCAGCCG, Cha Intron 4–7 forward GCAGGACTCGCAGTTCCTGCC, Cha Intron 4–7 reverse CGGATGCGGATTGTAGGAGCA, vAChT forward GGATGTCGTGCAAGTTGAGTGG, VAChT reverse GGAAATTGCTTAGCTCTCGC.

Reverse transcription for circRNAs was implemented using Super-Script II (Takara, Japan) as per the manufacturers’ instructions. Q-PCR was performed with a 1:10 dilution of the cDNAs with FastStart Universal SYBR Green Master Kit (Roche, Switzerland) and an ABI PRISM 7900HT sequence detection system was applied to execute the program (Applied Biosystems, U.S.). Two pairs of primers (convergent primers and divergent primers) were designed for each selected circRNA by primer 5 and are given in Supplementary Table 1. Theoretically, convergent primers were supposed to amplify the linear transcripts, while divergent primers were capable of achieving the circular amplification products. CDNAs transcribed from total RNAs served as templates, and genomic DNAs (gDNAs) were selected as a control. The RT-PCR protocol was as follows: first, 2 min at 50°C, followed by 10 min at 95°C, next to 40 cycles of PCR followed standard conditions with 15 s denaturation at 95°C, elongation at 60°C for 1 min, then at 95°C for 15 s, and 1 min for 60°C. The relative abundance was normalized to GAPDH, and fold change was analysed with the 2^-ΔΔCt method [50 (link)]. Error bars represent standard deviations. All the experiments were performed in triplicate.