Multiplex pcr kit

DNA has been collected from saliva on Indicating FTA-Elute paper (Millipore). A small disc was punched out and DNA eluted in 30 μl water. DRD4 genotyping was adapted from Carpenter et al. (2011) with the following modification: 1 μl of DNA solution was amplified in 10 μl in a Roche LightCycler with 0,5 μM primers ggcacgtcgcgccaagctgca and ctgcgggtctgcggtggagtct, with the Qiagen multiplex PCR kit and the addition of Q solution and 100 μM dITP. An initial 15 sec denaturation at 95 °C to activate the enzyme, was followed by 35 cycles of 10” denaturation at 98 °C, 10” annealing at 68 °C and 2′ elongation at 72 °C. The PCR product was then run on a 2% agarose gel. Microsatellites were genotyped as described in29 (link). D4S3248, D7S3056, D9S1121, D12S1300 and D13S894 were amplified with the Qiagen multiplex PCR kit, and analysed by capillary electrophoresis on a 3500xL Genetic Analyzer. Sequence of the primers:
D4S3248: 5′FAM ttcaggagtttagctttctatgc and ctacaccatcagtactcactaggc
D7S3056: 5′FAM caatagccctgaccttatgc and tacctacctacctacctctatggc
D9S1122: 5′AT550 gcttctgaaagcttctagtttacc and aatagtaatgccatttgtgatagg
D12S1300: 5′FAM cctcacaatgttgtaaggg and tgtaacatccgtgattaaaatagc
D13S894: 5′AT565 ggtgcttgctgtaaatataattg and cactacagcagattgcacca

All individuals were genotyped at 13 putatively neutral microsatellite DNA loci (Ssa85, Ssa171, Ssa197, Ssa20259 ; SSsp1605, SSsp221060 ; SsaA124, SsaD144, SsaD48661 ; SsoSL43862 ; CTAX, EST47, HSP63 (link); Table 1) and two MHC linked markers, Sasa-UBA-3′UTR and Sasa-DAA-3′UTR64 (link), in three multiplex reactions. Each individual was repeatedly genotyped at all loci, and 10% of the samples were genotyped in triplicate. Reactions were carried out according to the QIAGEN Multiplex PCR Kit reaction protocol in 8 ul volume. Each reaction included 4 ul of QIAGEN Multiplex PCR Kit reaction mixture, 2 mM of each primer and 2 ul of the extracted DNA solution. For the scale samples, 0.2 uM BSA was added to each reaction. The thermocycler profile consisted of 95 °C for 15 min, either 30 or 35 (tissue or scale DNA extraction, respectively) cycles of 94 °C 30 sec, 58 °C 90 sec, 72 °C for 30 sec and a final hold of 60 °C for 30 min. PCR products were run on a 3100 ABI Prism capillary sequencer using the Genescan-500 LIZ size standard. Alleles were scored using Genemapper V3.5 software (Applied Biosystems) and genotypes were manually checked.