Bac to bac baculovirus expression system

pFastBac1-His₆-DNA2-FLAG²⁹ allowed for the expression of codon-optimised human DNA2 in Sf9 insect cells. Site-directed mutagenesis was performed based on the QuikChange Site-Directed Mutagenesis (Stratagene) approach. Bacmids and baculoviruses were generated using the Bac-to-Bac Baculovirus Expression System (Invitrogen).
For expression in mammalian cells, human DNA2 cDNA was amplified from pBabe-hygro-3xFLAG DNA2 wt^{45 (link)}.The cDNA was cloned into pDONR221 GATEWAY entry vector (Invitrogen) according to the manufacturer’s protocol. Site-directed mutagenesis was performed based on the QuikChange Site-Directed Mutagenesis (Stratagene) approach. The pDONR221-DNA2 constructs were then cloned into GATEWAY destination vectors according to the manufacturer’s protocol.
HLTF cDNA was purchased from the Mammalian Gene Collection (Dharmacon) as bacterial stabs (clone ID: 6015181), cloned into pDONR221 GATEWAY entry vector and shuttled to GATEWAY destination vectors according to the manufacturer’s protocol (Invitrogen). Bacmids and baculoviruses were generated using the Bac-to-Bac Baculovirus Expression System (Invitrogen) approach.

BacMam baculovirus was generated in the Protein Expression Laboratory at the Frederick National Lab for Cancer Research (FNLCR) as described previously36 (link). In brief, the Bac-to-Bac Baculovirus Expression System (Life Technologies) was used according to the manufacturer’s protocol to generate recombinant BacMam baculovirus. Briefly, Gateway cloning was used to transfer fLuc cDNA from bacterial cloning plasmids to the pDest-625 expression vectors for BacMam baculovirus. Expression vectors were transformed into E. coli DH10Bac cells where site-specific transposition of the gene of interest into a baculovirus shuttle vector (bacmid) occurred. Blue-white screening was carried out, white colonies were selected, and bacmid DNA was purified by alkaline lysis. Bacmid DNA was transfected into insect cells to generate recombinant BacMam baculovirus.

Cloning and baculovirus production for AplCCal1, 1a and 1b, PKC Apl I, PKC Apl III has been described [35 (link), 47 (link), 48 (link)]. The CCal1alt unique N-terminal portion, along with a stretch of adjacent sequence common to both alternative transcripts was amplified from Aplysia nervous system cDNA (RNAqueous total RNA isolation kit and Superscript II reverse transcriptase, Thermo Fisher Scientific) using PCR with nested primers (5’ outer: GGAAGCTAGCAGGCATTCC, 5’ inner: GAGCTCCCATGTCTAACTACTACAAGACCC; 3’ outer: ATCACTCCAAGCACCTGTCC, 3’ inner: CCATAATGAGTCCGTTGGCC), cloned into pJET1.2 vector using the CloneJET PCR cloning kit (Thermo-Scientific) and used to replace the N-terminal region of AplCCal1 in pFastBac HT-A vector through digestion of both plasmids with SacI and ClaI followed by ligation. The C-S mutant was previously generated [17 (link)] in the pNEX3 vector and was transferred to the baculovirus vector using appropriate restriction enzymes. Baculovirus was generated in Spodoptera frugiperda (Sf9) cells using the Bac-to-Bac baculovirus expression system according to the manufacturer’s instructions (Life Technologies Inc, Burlington, Ontario).

Full-length ORFs of BdCPR and eGFP were amplified with primers containing BamH I and Xho I (Table S1) using PrimeSTAR Max DNA Polymerase (Takara). PCR products and pFastbac HT A vector (Life Technologies) were digested with BamH I and Xho I (Thermo Scientific) for 1 h and then PCR products were inserted into vectors with T4 DNA Ligase (Promega). The vector containing the eGFP gene was used to produce a control virus. The recombinant baculovirus DNA was constructed and transfected to Sf9 cells (Life Technologies, Gibco) using the Bac-to-Bac baculovirus expression system (Life Technologies) according to the manufacturer’s instructions. Sf9 cells were suspension cultured under serum-free conditions (SF-900 II SFM, Gibco) at 27 °C. Insect cells grown to a density of 2 × 10⁶ cells mL⁻¹ were infected with recombinant baculovirus containing either BdCPR or eGFP. Baculovirus-infected cells were harvested 72 h post infection by centrifugation at 2,000 × g for 10 min and washed with PBS (100 mM, pH 7.8). Cells were resuspended in one-tenth cell culture volume of cell lysate buffer, sonicated for 1 min on ice, and centrifuged at 10,000 × g for 10 min. Supernatants were used immediately or frozen in liquid nitrogen and stored at −80 °C.

The Bac-to-Bac Baculovirus Expression System (Life Technologies, Carlsbad, CA) was used to generate recombinant BacMam baculovirus as described previously^{27 (link),31 (link)}.

The hCBP80 cDNA was amplified from human cDNA by PCR and cloned into pFastBac Htb digested with BamHI and XhoI. The hCBP80 Bacmid clone was prepared using Bac-to-Bac Baculovirus Expression System (Life Technologies) and introduced to Sf9 cells by Cellfectin II transfection reagent (Life Technologies) according to the manufacturer's instruction. For protein production, Sf9 cells were infected at MOI = 5. After viral amplification for 3 days, the infected cells were harvested and used for the hCBP80 purification by Ni-NTA agarose (Qiagen). The final eluate was dialyzed against the storage buffer [10 mM Hepes (7.9), 200 mM NaCl, 20% Glycerol] and concentrated. Anti-hCBP80 mouse monoclonal antibodies were raised at Immuno-Biological Laboratories Co, Ltd (Fujioka, Japan).