Cxcl1

An enzyme-linked immunosorbent assay (ELISA) was used to measure the concentrations of CXCL1 (Abcam, UK), and CXCR2 (Wuhan Fine Biotech Co., Wuhan, China) in the L4-5 levels of left spinal cord [24 (link)]. Spinal cord tissues were homogenized in a lysis buffer containing protease and phosphatase inhibitors. Tissue samples were centrifuged at 12,500× g for 10 min and the supernatant was collected. BCA Protein Assay (Pierce) was employed to determine protein concentrations. For each reaction in a 96-well plate, 100 μg of proteins from the samples was used. All ELISA experiments followed the manufacturer’s protocol. The optical densities of samples were measured using an ELISA plate reader (Bio-Rad, Hercules, CA, USA) at a wavelength of 450 nm and the levels of CXCL21 and CXCR2 were calculated using the standard curves and normalized to the total protein levels.

Cell Counting Kit 8 (CCK8) and colony formation assays were employed to evaluate cell proliferation. In the CCK8 assays, cells were plated into 96-well plates at a density of 2 × 10³ cells/well, and cultured at 37°C for 24 h. CCK8 was added to the wells and incubated for 1.5 h. The optical density in each well was measured by a Biotek Elx800 microplate reader (Bio-tek, Currumbin VT, USA) at 450 nm. In the colony formation assay, different groups of cells were plated at a density of 1 × 10³ cells/well into the 6-well plates (containing 0.6% base agar and 0.3% top agar) and incubated at 37°C for 15 days and the cells were finally stained with 0.5% crystal violet (Sigma-Aldrich, St. Louis, MO, USA). CXCL1 protein (Abcam Co., Cambridge, MA, USA) was added to specific wells at 100 ng/mL for 2–4 h. Chemokine (C-X-C motif) receptor 2 (CXCR2) antibody (Abcam Co., Cambridge, MA, USA) was added to antagonize the effects of CXCL1 at 5 μg/mL for 1 h [31 (link)].

Total proteins were harvested using RIPA (Beyotime Biotechnology). Proteins were separated using 8% SDS-PAGE and the separated proteins were transferred onto PVDF membranes (Millipore, Braunschweig, Germany). PVDF membrane was incubated with CXCL1 or GAPDH (Abcam, Cambridge, UK) at 4 °C for overnight. After that, the membranes were incubated with a secondary antibody (Beyotime Biotechnology). Finally, bands were measured by using enhanced chemiluminescence (ECL) detection system.

The levels of serum matrix metalloproteinase-9 (MMP-9) (Biolegend, San Diego, CA), IL-1β (Biolegend), TNF-α and IL-17 (Life Technologies, Carlsbad, CA), and CXCL-1 (Abcam, Cambridge, UK) were measured by ELISA using commercially available kits according to the instruction of the manufacturers. Expression of MMP-9, IL-1β, TNF-α, and IL-17 was also measured by quantitative real-time PCR. To that end, total RNA was isolated from rat synovial tissue and extracted using TRIzol Reagent (Life Technologies, Carlsbad, CA). For cDNA synthesis, we used iScript cDNA Synthesis Kits (BioRad, Hercules, CA). Real-time PCR was performed using Q SYBR Green Supermix (BioRad). The following primers were used: (1) MMP-9 (forward: GGATGGTTATCGCTGGTG; reverse: AGTAGGACAGAAGCCATACA), (2) IL-1β (forward: TTCGACAGTGAGGAGAATGACC; reverse: CAAGACATAGGTAGCTGCCACA), (3) TNF-α (forward: CCTCACACTCAGATCATCTTCTCA; reverse: CTCCTCCGCTTGGTGGTT), (4) CXCL-1 (forward: ACCGAAGTCATAGCCACACTC;, reverse: CGCCATCGGTGCAATCTATCT), and (5) IL-17 (forward: CATCCATGTGCCTGATGCTGTTG; reverse: GGAACGGTTGAGGTAGTCTGAGG). The data were normalized to the expression levels of β-actin (forward primer: CAACGGCTCCGGCATGTGC, reverse primer: CTCTTGCTCTGGGCCTCG). The PCR conditions were 40 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s.

Serum RF was detected by a Rat RF ELISA Kit (Catalog Number CSB-E13666r, CUSABIO, Houston, TX, USA), and serum levels of CRP and ANA were assayed using cytokine ELISA kits (Invitrogen, Waltham, MA, USA), following the manufacturer’s protocol.
The levels of TNF-α, IL-6, IL-17a (Life Technologies, Carlsbad, CA, USA), CCL2, IL-1β (Biolegend, San Diego, CA, USA) and CXCL-1 (Abcam, Cambridge, UK) in synovial fluids were measured by ELISA using commercially available kits according to the instruction of the manufacturers. In order to obtain the synovial fluid, the right knee of each rat was cut and the joint cavity was exposed under aseptic conditions on day 28. The cavity was then subjected to lavage with 1 mL saline and 0.5 mL synovial fluid was aspirated. The synovial fluid specimens were centrifuged at 4500 r/min for 10 min, then the supernatant was stored in Eppendorf tubes at −80 °C. And the detection and calculation service of ELISA were provided by Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China.

Mouse IL-17, CXCL1, and Albumin Enzyme-Linked ImmunoSorbent Assay (ELISA) Kit were obtained from Abcam. Serum was incubated with antibody cocktail for 1 h. After three times washing, the supernatant was discarded and Streptacidin-horseradish peroxidase solution was added for 1 h. After incubating TMB (3,3′, 5,5; -tetramethylbenzidine) chromogen solution for 10 min, stop solution was utilized. OD was read at 450 nm.