Bend 3 cells

Manufactured by American Type Culture Collection

Sourced in United States

BEnd.3 cells are a cell line derived from mouse brain endothelial cells. They are widely used in research to study the properties and functions of the blood-brain barrier.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

BEnd.3 (155 citations) BEnd.3 cell line (12 citations) BEND cells (3 citations) Mouse brain microvascular endothelial cells (bEnd.3) (2 citations) BEND.3 endothelial cells (2 citations)

60 protocols using bend 3 cells

Transwell Assay for Macrophage Uptake

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transwell (3 µm diameter, Invitrogen, Eugene, OR, USA) inserts were infused with 0.3% gelatin (w/v) (Sigma‐Aldrich) for 24 h followed by the transfer of 5 × 10³ bEnd.3 cells (purchased from ATCC, Manassas, VA, USA). At the same time, M2 BMDM, BV2, and LLC cells were cultured in the lower insert of the Transwell. After culturing in the insert for 3 d, RMPs, RMPs‐R4F, or P5091@RMPs‐R4F stained with PKH26 were added to the upper insert and the culture was incubated in 5% CO₂ at 37 °C for 24 h, followed by quantitative assessment of cellular uptake in the lower inset through flow cytometry.

Lu L., Zi H., Zhou J., Huang J., Deng Z., Tang Z., Li L., Shi X., Lo P., Lovell J.F., Deng D., Wan C, & Jin H. (2023). Engineered Microparticles for Treatment of Murine Brain Metastasis by Reprograming Tumor Microenvironment and Inhibiting MAPK Pathway. Advanced Science, 10(8), 2206212.

+ Open protocol

+ Expand

ICAM-1 Binding Peptide Expression and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

bEnd.3 cells (ATCC CRL-2299) were from ATCC (Manassas, VA). SHuffle T7 Competent E. coli was from New England BioLabs Inc. (Ipswich, MA). DNA oligos encoding ICAM-1 Binding Peptide with BseRI sticky ends (/5Phos/GATTACCGACGGCGAAGCGACCGATAGCGGCGG, /5Phos/GCCGCTATCGGTCGCTTCGCCGTCGGTAATCCC) was synthesized by Integrated DNA Technologies (Coralville, IA). The plasmid expressing mICAM-1 turboGFP was from Origene (Rockville, MD). Rapamycin was from LC Laboratories (Woburn, MA, U.S.A.). NHS-Fluorescein, NHS-Rhodamine, and Zeba™ Spin Desalting Columns, 7K MWCO (10 mL), and LysoTracker™ Green DND-26 were from ThermoFisher Scientific Inc. (Rockford, IL). Sulfo-Cyanine 7.5 NHS ester was from Lumiprobe Corp (Hallandale Beach, FL). Goat antimouse ICAM-1 polyclonal antibody was from R&D Systems (Minneapolis, MN). Other reagents were from standard suppliers.

Ju Y., Guo H., Yarber F., Edman M.C., Peddi S., Janga S.R., MacKay J.A, & Hamm-Alvarez S.F. (2019). Molecular Targeting of Immunosuppressants Using a Bifunctional Elastin-Like Polypeptide. Bioconjugate chemistry, 30(9), 2358-2372.

+ Open protocol

+ Expand

Murine Brain Endothelial Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine brain endothelial cells (bEnd.3 cells; ATCC, Manassas, VA, USA) were cultured in Dulbecco's modified Eagle's medium (Hyclone Laboratories, South Logan, UT, USA) supplemented with 10% (v/v) fetal bovine serum (Hyclone Laboratories, South Logan, UT, USA) and 100 units/mL penicillin/streptomycin (Hyclone Laboratories, South Logan, UT, USA) at 37°C in a humidified atmosphere in the presence of 5% CO₂ [43 (link)]. bEnd.3 cells were used after 13 passages.

Song J., Park J., Oh Y, & Lee J.E. (2015). Glutathione Suppresses Cerebral Infarct Volume and Cell Death after Ischemic Injury: Involvement of FOXO3 Inactivation and Bcl2 Expression. Oxidative Medicine and Cellular Longevity, 2015, 426069.

+ Open protocol

+ Expand

Culturing Murine Brain Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Commercially available bEnd3 cells (murine, brain endothelial cells; ATCC, France) were cultured in high glucose DMEM supplemented with 10% FBS (fetal bovine serum), 2 mM L-glutamine, and 1% penicillin/streptomycin (see details in Supplementary Table 1).

Sokol L., Cuypers A., Truong A.C., Bouché A., Brepoels K., Souffreau J., Rohlenova K., Vinckier S., Schoonjans L., Eelen G., Dewerchin M., de Rooij L.P, & Carmeliet P. (2023). Prioritization and functional validation of target genes from single-cell transcriptomics studies. Communications Biology, 6, 648.

+ Open protocol

+ Expand

Immortalized Mouse Brain Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The immortalized mouse brain microvascular ECs (bEnd.3 cells) were from ATCC (USA). bEnd.3 cells were cultured in a complete culture medium which contained 10% fetal bovine serum, streptomycin 0.1 mg/mL and penicillin 100 U/mL (Gibco, USA) in an incubator (37 °C, 5% CO₂/95% air). The culture medium was changed every 2 days. The cells were passaged when they grew to 90%, and the logarithmic growth phase cells were selected for experiment.

Xie Y.Y., Lu Y.W, & Yu G.R. (2022). The protective effects of hyperoside on Ang II-mediated apoptosis of bEnd.3 cells and injury of blood-brain barrier model in vitro. BMC Complementary Medicine and Therapies, 22, 157.

+ Open protocol

+ Expand

Cell Line Maintenance and Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

As reference for the qRT-PCR analyses, 3T3 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained as recommended. Bone marrow derived endothelial cells (BMEC) were obtained from Dr. Yi Zheng (Cincinnati Children’s Hospital Medical Center) and maintained with mEPOC medium with EPOC supplement (US Biological, Salem, MA). The bEnd3 cells were purchased from ATCC and cultured as recommended in DMEM medium.

Dai M., Lin Y., El-Amouri S.S., Kohls M, & Pan D. (2018). Comprehensive evaluation of blood-brain barrier-forming micro-vasculatures: Reference and marker genes with cellular composition. PLoS ONE, 13(5), e0197379.

+ Open protocol

+ Expand

Culturing Mouse Cerebral Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse microvascular cerebral endothelial cells (bEnd.3 cells; ATCC CRL-2299) were grown in DMEM media (containing 10% fetal bovine serum [FBS]) at 37 °C in a humidified 5% CO₂ atmosphere^{23 (link)}. Cells were passaged every 3–4 days. Culture media was changed after 24 h of passaging and every 2 days thereafter. Experiments were performed with cells from passages 26 to 34.

Bernard A., Ku J.M., Vlahos R, & Miller A.A. (2019). Cigarette smoke extract exacerbates hyperpermeability of cerebral endothelial cells after oxygen glucose deprivation and reoxygenation. Scientific Reports, 9, 15573.

+ Open protocol

+ Expand

Murine Cell Lines for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine OS LM8 cell line24 was gifted by Dr Hideki Yoshikawa (Osaka University, Osaka, Japan). All LM8 sublines were cultured in DMEM supplemented with 5% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL at 37°C, 5% CO₂). Murine vascular endothelia bEnd.3 cells were purchased from the ATCC (Manassas, VA, USA). bEnd.3 cells were cultured in DMEM supplemented with 10% FBS, penicillin (100 U/mL), and streptomycin (100 μg/mL) at 37°C, 5% CO₂.

Pongsuchart M., Kuchimaru T., Yonezawa S., Tran D.T., Kha N.T., Hoang N.T., Kadonosono T, & Kizaka‐Kondoh S. (2018). Novel lymphoid enhancer‐binding factor 1‐cytoglobin axis promotes extravasation of osteosarcoma cells into the lungs. Cancer Science, 109(9), 2746-2756.

+ Open protocol

+ Expand

bEnd.3 Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The bEnd.3 cells (ATCC, VA, USA) were maintained in EGM-2-MV Medium (Lonza, Switzerland) containing 10% fetal bovine serum and supplemented with SingleQuot Kit (Lonza, Switzerland) according to the standard protocol recommended by the manufacturer.

Yuen D., Leu R., Tse J., Wang S., Chen L.L, & Chen L. (2014). NOVEL CHARACTERIZATION OF bEnd.3 CELLS THAT EXPRESS LYMPHATIC VESSEL ENDOTHELIAL HYALURONAN RECEPTOR-1. Lymphology, 47(2), 73-81.

+ Open protocol

+ Expand

Culturing Mouse Brain Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immortalized mouse brain endothelial cells (ECs), bEnd.3 cells (ATCC, Manassas, VA, USA), were cultured in Dulbecco’s modified Eagle’s medium (DMEM, 4500 mg/L D-glucose, L-glutamine, 110 mg/L sodium pyruvate, 1.5 g/L sodium bicarbonate; Welgene, Daegu, Korea) supplemented with 10% fetal bovine serum (FBS, Mediatech Inc., Manassas, VA, USA), 100 units/mL penicillin, and 100 μg/mL streptomycin (Welgene). bEnd.3 cells were incubated in a humidified incubator containing 5% CO₂ at 37 °C until confluence.

Kim D., Kim K.A., Kim J.H., Kim E.H, & Bae O.N. (2020). Methylglyoxal-Induced Dysfunction in Brain Endothelial Cells via the Suppression of Akt/HIF-1α Pathway and Activation of Mitophagy Associated with Increased Reactive Oxygen Species. Antioxidants, 9(9), 820.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!