Sybr premix

The designation procedure for quantitative fluorescent RT-PCR primers was as per the transcriptome sequences using Primer 5 software (Table 2).Table 2

proPO, LSZ, MT, and β-actin primers used in Real-time PCR.

Genes	Sequences of specific primers (5′–3′)	Length (nt)	TM (°C)
Prophenoloxidase (proPO)	F- TGCCTTAGGGGTGTTTTA	18	61
	R- CAGGGTGACTGGTCTTGG	18
lysozyme (LSZ)	F- GAGGATGTGGTCGTGGGTGA	20	67
	R- ATTGGTCGTTCTAATGCCGC	20
metallothionein (MT)	F- CTGCTCTGGAGTAGGGTTCG	20	68
	R- GCTCTCGTGAAGACTTATGGCG	22
β-actin	F- GCTGTTATGGTTGGTATGGGTC	22	67
	R- TCGGTGAGAAGAACGGGG	18

In order to compare the relative levels of expression of proPO, LSZ, and MT in the samples, the housekeeping gene β-actin was also amplified with the same cDNA samples. The RT-qPCR was carried out in a total volume of 20 µl, containing 10 µl of 2 × SYBR Premix (TaKaRa), 0.4 µl of each primer (10 µM), 0.4 µl ROX dye П, 2 µl of the diluted cDNA and 6.8 µl ddH₂O. The thermal profile for RT-qPCR was 30 s at 95 °C for 1 cycle, 5 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C for 40 cycles. An ABI 7500 real-time detection system (Applied Biosystems, Foster City, CA, USA) was utilized to run the RT-qPCR using SYBR Premix Ex Taq II (Takara, Dalian, China) based on the manufacturer's protocol. The proposed experiments were done in triplicates involving NTC. Fold change for the gene expression relative to controls was determined by the 2^−ΔΔCt method^{73 (link)}.

The copy number of Dehalococcoides 16S rRNA genes was determined by quantitative PCR using an Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies, Gaithersburg, MD, USA). The primers, 624-Fw (5′-CAGCAGGAGAAAACGGAATT-3′) and 1232-Rv (5′-GACAGCTTTGGGGATTAGC-3′), have been described previously (30 ). Each 25-μL reaction mixture contained 10.8 μL of sterilized deionized water, 12.5 μL 2×SYBR Premix (Takara Bio), 0.1 μL 624-Fw primer (100 μM), 0.1 μL 1232-Rv primers (100 μM), 0.5 μL 50×ROX Dye (Takara Bio), and 1 μL extracted DNA. PCR was conducted by subjecting the samples to 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 54°C for 30 s, and 72°C for 45 s.

Quantitative polymerase chain reaction (qPCR) was performed with a real-time polymerase chain reaction system (PRISM 7900HT; Applied Biosystems, Foster City, CA). All reactions were performed at least in duplicate. Comparison with other bacterial quantification methods was facilitated by converting the number of molecules detected (DNA) into cell equivalents. A culture of the reference bacterial strain indicated (grown in the appropriate medium and collected at stationary phase) was used to generate a standard curve of threshold cycle against bacterial cell number (determined microscopically with 4 = 6-diamidino-2-phenylindole staining from a dilution series of the reference strains). Standard curves of DNA from Bifidobacterium longum were plotted with 10⁶ to 10¹⁰ cells. Samples were analyzed in a 25-µl reaction mixture consisting of 12.5 µl SYBR Premix (50 mmol/L KCl, 20 mmol/L Tris-HCl, pH 8.4, 0.2 mmol/L deoxynucleoside triphosphate, 0.625 U Ta-KaRa Taq (Clonetech, Mountain View, CA), 3 mmol/L MgCl₂, and 10 nmol/L fluorescein), 0.2 mol/L of each primer, and 5 µl of DNA. Serial dilutions (100–1000-fold) of extracted DNA were subjected to quantitative polymerase chain reaction with the Uni331F (5′-TCCTACGGGAGGCAGCAGT-3′) and Uni797R (5′-GGACTACCAGGGTATCTAATCCTGTT-3′) primers.