Vii7 real time pcr system

ChIP assays were performed using a ChIP Kit (Cat. no. #9003; CST) according to the manufacturer’s instructions. Briefly, cells were cross-linked with formaldehyde and sonicated to an average length of 200–1,000  bp. Immunoprecipitation was conducted against H3K27me3 (Cat. no. #9733; CST), Suz12 (Cat. no. #3737; CST), or IgG control. The immunoprecipitated DNA was quantified by RT-PCR in a Vii7 Real-Time PCR System (Applied Biosystems). The primer sequences are as follows:
Timp3-1 kb
F: 5′-ACAAGTTGTAGTCTGTGCGGG-3′,
R: 5′-GGCGCGGGAGATAAGCAATC-3′;
Timp3-1.3 kb
F: 5′-GATAGCTGGCCTGAGGTGAC-3′,
R: 5′-CTCACAAACATTCCGGGGGA-3′;
Timp3-1.6 kb
F: 5′-TGCCAAAGGTCTCATCGCTT-3′,
R: 5′-TCCCCAACACTCCTCTGGAT-3′;
ActbF: 5′-CGTATTAGGTCCATCTTGAGAGTACACAGTATT-3′,
R: 5′-GCCATTGAGGCGTGATCGTAGC-3′.

Total RNA of skin tissue and cells was isolated using the Trizol reagent (Invitrogen) and RNeasy mini Kit (GeneMark), respectively. Reverse transcription was performed via PrimeScript RT MasterMix (TAKARA) according to the manufacturer’s instructions. Quantitative PCR was carried out with SYBR Green PCR Master Mix (Applied Biosystems) in a Vii7 Real-Time PCR system (Applied Biosystems). Relative mRNA levels were determined with HPRT as a reference gene. The primer sequences were used as indicated in Table 1. For cytokine detection in skin tissue, 45 mg skin tissue were weighted and homogenized in 0.5 ml ice-cold CelLytic™ MT Cell Lysis Reagent (Sigma-Aldrich). Concentration of CXCL2, IL-1β, and IFN-γ in homogenized supernatants was measured by ELISA according to the manufacturer’s instructions (eBioscience). Immunoblot analyses were performed as described (25 (link)) with antibody to p38 phosphorylated at Thr180 and Tyr182 (D3F9), antibody to ERK phosphorylated at Thr202 and Tyr204 (D13.14.4E), and antibody to IκBα phosphorylated at Ser32 (14D4) (all from Cell Signaling Technology) and GAPDH (Proteintech).

RNA was extracted using RNAiso following the manufacturer’s instructions. RNA was reverse transcribed using a PrimeScript RT Kit with gDNA eraser following the manufacturer’s instructions. Quantitative real-time PCR was performed with an Applied Biosystems Vii-7 Real-Time PCR system using SYBR Premix Ex Taq II. β-actin was used as a reference gene, and relative gene expression was calculated using the 2^−∆∆CT method. The primer sequences utilized are listed in Table 1.

Naive CD4+CD62L+CD44-Foxp3−, CD4+Foxp3+, TCRγδ+LAP+ and TCRγδ+LAP− cells were sorted and RNA was extracted with a miRNeasy kit (Qiagen), then was reverse-transcribed with a high capacity cDNA reverse transcription kit (Applied Biosystems) and analysed by quantitative RT–PCR with a Vii 7 Real-time PCR system (Applied Biosystems) with the following primers and probes (from Applied Biosystems; identifier in parentheses): Tgfb1 (Mm00441724_m1), Ifng (Mm00801778_m1), Il17a (Mm00439619_m1), Atf3 (Mm00476032_m1), Foxp3 (Mm00475156_m1), Tnfa (Mm004433258_m1), Il6 (Mm00446191_m1), Il10 (Mm00439616_m1), Il22 (Mm00444241_m1), Ccl2 (Mm00441242_m1), Ccl5 (01302427_m1) and Cxcl10 (Mm00445235_m1). The comparative threshold cycle method and the internal control Gapdh (Mm99999915-g1) was used for normalization of the target genes.

DNA in the mouse feces was extracted using a QIAamp Fast DNA Stool Mini Kit (Qiagen) and verified for specific bacteria abundance. RT-qPCR was conducted using a with a Vii 7 real-time PCR system (Applied Biosystems). R. gnavus and A. muciniphila were quantified by Taqman amplification reactions consisting of DNA, TaqMan Universal PCR Master Mix (Applied Biosystems), and primer pairs as follows: All bacteria (universal 16S rDNA, reference): Forward: TCCTACGGGAGGCAGCAGT, Reverse: GGACTACCAGGGTATCTAATCCTGTT, Probe: CGTATTACCGCGGCTGCTGGCAC [14 (link)]; R. gnavus 16S rRNA gene: Forward: CGCAGCAAACGCAATAAGTA, Reverse: CTGTCTCCTCTGTCCCGAAG, Probe: AAGCAACGCGAAGAACCTTA. A. muciniphila 16S rRNA gene: Forward: CGGTGGAGTAT GTGGCTTAAT, Reverse: CCATGCAGCACCTGTGTAA, Probe: CGCCTCCGAAGAGTCGCATG. The relative quantity was calculated using the comparative CT method normalizing to the amount of all bacteria in the sample [15 (link)].