Log In Sign up
The largest database of trusted experimental protocols

Afatinib

Manufactured by MedChemExpress
Visit Supplier
Sourced in United States

Afatinib is a tyrosine kinase inhibitor. It is a lab equipment product available from MedChemExpress.

Automatically generated - may contain errors

Lab products found in correlation

Fitc conjugated anti rabbit igg, by Thermo Fisher Scientific (1 mentions) Cck 8 reagent, by Merck Group (1 mentions) On targetplus smartpool sirna, by Horizon Discovery (1 mentions) Erlotinib, by MedChemExpress (1 mentions) Osimertinib, by MedChemExpress (1 mentions) Pd0325901, by MedChemExpress (1 mentions) Bez235, by MedChemExpress (1 mentions) Hydrocortisone, by Lonza (1 mentions) Chir99021, by Merck Group (1 mentions) Sb216763, by Merck Group (1 mentions) Mda mb 231, by Thermo Fisher Scientific (1 mentions) Bt474, by American Type Culture Collection (1 mentions) Bt474, by Thermo Fisher Scientific (1 mentions) Mda mb 231, by American Type Culture Collection (1 mentions) Streptomycin, by Thermo Fisher Scientific (1 mentions) Penicillin, by Thermo Fisher Scientific (1 mentions) Mcf 7, by American Type Culture Collection (1 mentions) Mcf 7, by Thermo Fisher Scientific (1 mentions) Celltiter 96 aqueous one solution cell proliferation kit, by Promega (1 mentions) Cleaved caspase 3, by Cell Signaling Technology (1 mentions)

9 protocols using afatinib

1

Modulation of DSE-Mediated Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant HB-EGF, NRG1, and EGF protein were purchased from PeproTech. Full length DSE-pcDNA3.1 plasmid was purchased from GeneScript. Two pLKO.1/DSE-shRNA plasmids (DSE sh1, 5’- CAGAAAGAACTACCCATAGAT -3’; DSE sh2, 5’- CAGAAAGAACTACCCATAGAT -3’) and nontargeting pLKO.1 plasmids were purchased from National RNAi Core Facility (Academia Sinica, Taipei, Taiwan). ON-TARGETplus SMARTpool siRNA against human DSE was purchase from Dharmacon. CCK8 reagent was purchased from Sigma-Aldrich. Rabbit polyclonal anti-DSE antibody was purchased from Sigma-Aldrich. The immunogen of this DSE antibody is from human DSE sequence which is 87% identical to mouse Dse sequence. Antibodies against p-AKT, p-ERK1/2, ERK1/2, p-EGFR (Y1068), EGFR, and p-ErbB2(Y1248) were purchased from Cell Signaling Technology. Antibodies against total AKT and Actin were purchased from GeneTex, Inc. Antibody against ErbB2 was purchased from Santa Cruz Biotechnology. FITC conjugated anti-rabbit IgG was purchased from Invitrogen. HRP conjugated-DS binding protein was purchased from Lifespan Technologies. The dual EGFR/HER2 inhibitor, Afatinib, was purchased from MedChemExpress.
Liao W.C., Liao C.K., Tsai Y.H., Tseng T.J., Chuang L.C., Lan C.T., Chang H.M, & Liu C.H. (2018). DSE promotes aggressive glioma cell phenotypes by enhancing HB-EGF/ErbB signaling. PLoS ONE, 13(6), e0198364.
+ Open protocol
+ Expand
2

Tumor Growth Inhibition by EGFR Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
ASC tumor cells were transplanted into age-matched C57BL/6 mice in order to generate tumors. Treatment with afatinib (12.5 mg/kg; MedChemExpress) or erlotinib (12.5 mg/kg; MedChemExpress) in 0.5% hydroxyl propyl methyl cellulose and 0.1% Tween 80 in H2O by oral gavage was started 10 days after tumor cell injection. For the analysis of tumor burden at 4 weeks after injection (Fig. 4A-B), mice were treated with afatinib 3 days per week. In the survival analysis, mice were treated five times per week and euthanized when their weight dropped more than 20% or their health weakened. Mice were euthanized by cervical dislocation and tumors were collected for IHC analysis.
Lähdeniemi I.A., Devlin J.R., Nagaraj A.S., Talwelkar S.S., Bao J., Linnavirta N., Şeref Vujaklija C., Kiss E.A., Hemmes A, & Verschuren E.W. (2022). Development of an adenosquamous carcinoma histopathology – selective lung metastasis model. Biology Open, 11(12), bio059623.
+ Open protocol
+ Expand
3

EGFR Inhibition Assay for Novel Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
We performed in vitro EGFR inhibition assay for all our newly synthesised compounds (6a–p) against both wild-type EGFR and the double mutant EGFRL858R/T790M purchased from AssayQuant Technologies, Inc. (Marlboro, MA, USA) as per the manufacturer’s instructions. Osimertinib and afatinib were purchased from MedChemExpress LLC (Monmouth Junction, NJ, USA) and used as references.
Kothayer H., Rezq S., Abdelkhalek A.S., Romero D.G, & Elbaramawi S.S. (2023). Triple targeting of mutant EGFRL858R/T790M, COX-2, and 15-LOX: design and synthesis of novel quinazolinone tethered phenyl urea derivatives for anti-inflammatory and anticancer evaluation. Journal of Enzyme Inhibition and Medicinal Chemistry, 38(1), 2199166.
+ Open protocol
+ Expand
4

Synchronization and TGFA Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded on six-well plates at the density of 200.000 cells/well. When cells reached 80% confluency they were washed with PBS and synchronized with basal media containing 0.5% FBS. After 16 hr 50 ng/ml of recombinant human (rh)TGFA (Sigma-Aldrich) and/or Afatinib (5 µM, MedChem Express, Monmouth Junction, NJ) was added to the wells. The corresponding concentration of DMSO was used as a control for Afatinib.
Jauhiainen S., Ilmonen H., Vuola P., Rasinkangas H., Pulkkinen H.H., Keränen S., Kiema M., Liikkanen J.J., Laham-Karam N., Laidinen S., Beter M., Aavik E., Lappalainen K., Lohi J., Aronniemi J., Örd T., Kaikkonen M.U., Salminen P., Tukiainen E., Ylä-Herttuala S, & Laakkonen J.P. (2023). ErbB signaling is a potential therapeutic target for vascular lesions with fibrous component. eLife, 12, e82543.
+ Open protocol
+ Expand
5

Cell Culture and Synchronization Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Unless indicated, chemicals were from Sigma-Aldrich. Cell lines were purchased from the American Type Culture Collection. MCF10A cells were grown in Dulbecco’s modified Eagle’s medium (DMEM)/F12 supplemented with antibiotics, insulin (10 μg/ml), cholera toxin (0.1 μg/ml), hydrocortisone (0.5 μg/ml), heat-inactivated horse serum (5%, v/v), and EGF (10 ng/ml). The 184A1 cells were grown in mammary epithelial cell growth medium (MEGM) (Lonza, Basel, Switzerland) mixed 1:1 with DMEM/F12, supplemented with insulin, EGF, and hydrocortisone. MDA-MB-231, HCC70, and 4T1 cell lines were cultured in RPMI with 10% serum. HEK293T and HeLa cells were cultured in DMEM containing fetal bovine serum (10%). All cell lines were incubated at 37°C and 5% CO2. For time series experiments, cells were starved overnight in DMEM/F12 or MEGM without additives (starvation medium), and EGF was added to a final concentration of 10 ng/ml. All inhibitors (from MedChem Express; afatinib, PD0325901, everolimus, BEZ235, AKT-VIII, and BAY 11-7085) were dissolved in dimethyl sulfoxide. For cell cycle synchronization, HEK293T cells were arrested in different phases as follows: serum withdrawal for 17 hours followed by addition of serum for 1 hour (G0/G1), 2 mM thymidine (G1/S, 18 hours), or nocodazole (100 ng/ml) (G2/M, 18 hours).
Uribe M.L., Dahlhoff M., Batra R.N., Nataraj N.B., Haga Y., Drago-Garcia D., Marrocco I., Sekar A., Ghosh S., Vaknin I., Lebon S., Kramarski L., Tsutsumi Y., Choi I., Rueda O.M., Caldas C, & Yarden Y. (2021). TSHZ2 is an EGF-regulated tumor suppressor that binds to the cytokinesis regulator PRC1 and inhibits metastasis. Science signaling, 14(688), eabe6156.
+ Open protocol
+ Expand
6

Pharmacological Inhibitors in Cell Biology Research

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Osimertinib, CO1686, erlotinib, MG132, actinomycin D (Act D), trametinib, selumetinib (AZD6244), cycloheximide (CHX), GDC0994 (ravoxertinib) and VRT752271 (ulixertinib or BVD-523) were the same as described previously (15 (link)–17 (link)). EGF816 and afatinib were purchased from MedChem Express (MCE; Monmouth Junction, NJ). JQ1, OTX015, ZBC260 and dBET were described in our previous studies (18 (link),19 (link)). SB216763 and CHIR99021 were purchased from Sigma Chemical Co. (St. Louis, MO) and LC Laboratories (Woburn, MA), respectively. c-Myc (#5605), p-c-Myc (S62; #13748) and p-c-Myc (T58/S62; #9401) antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA). FBXW7 (A301-721A) antibody was purchased from Bethyl Laboratories, Inc. (Montgomery, TX). Other antibodies were the same as described in our previous studies (15 (link),16 (link),20 (link),21 (link)).
Zhu L., Chen Z., Zang H., Fan S., Gu J., Zhang G., Sun K.D., Wang Q., He Y., Owonikoko T.K., Ramalingam S.S, & Sun S.Y. (2021). Targeting c-Myc to overcome acquired resistance of EGFR mutant NSCLC cells to the third generation EGFR tyrosine kinase inhibitor, osimertinib. Cancer research, 81(18), 4822-4834.
+ Open protocol
+ Expand
7

Afatinib Cytotoxicity on Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Afatinib was purchased from Medchem express (Monmouth Junction, NJ). Breast cancer cell lines BT474, MCF-7 and MDA-MB-231 were obtained from the American Type Culture Collection. BT474 and MDA-MB-231 cells were cultured in DMEM medium and MCF-7 cells were cultured in RPMI-1640 medium and both mediums were supplemented with 10% fetal bovine serum (FBS), 100 unit/ml penicillin and 100 μg/ml streptomycin (Thermo Fisher Scientific, Waltham, MA). All cells were maintained at 37°C in a humidified incubator containing 5% CO2. Cancer cells were seeded at a density of 3,000–5,000 per well in 96-well plates and then treated with indicated concentrations of Afatinib for 72 h. Cell viability was evaluated using CellTiter 96 AQueous One Solution Cell Proliferation kit (Promega, Madison, WI) according to the manufacturer’s protocol. The half maximal inhibitory concentration (IC50) value was determined from the results of at least three independent tests.
Liu C., Zhao J., Lu W., Dai Y., Hockings J., Zhou Y., Nussinov R., Eng C, & Cheng F. (2020). Individualized genetic network analysis reveals new therapeutic vulnerabilities in 6,700 cancer genomes. PLoS Computational Biology, 16(2), e1007701.
+ Open protocol
+ Expand
8

Novel KRAS/NRAS Inhibitor Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
143D((S)-2-(4-(7-(8-chloronaphthalen-1-yl)-2-((tetrahydro-1H-pyrrolizin-7a(5H)-yl) methoxy)-5,6,7,8tetrahydro-1,7-naphthyridin-4-yl)-1-(2-fluoroacryloyl) piperazin-2-yl) acetonitrile, WO2022/170947) was provided by Suzhou AlphaMa Biotechnology Co., Ltd. (Suzhou, China). MRTX1133, AMG510, MRTX849, BI3406, trametinib, SCH772984 and afatinib were purchased from MedChemExpress (Monmouth Junction, NJ, USA). Antibodies specific to MEK1/2, phospho-MEK1/2 (Ser217/221), AKT, phospho-AKT (Ser473), phospho-ERK1/2 (Thr202/Tyr204), ERK1/2, phospho-rpS6 (Ser235/236), rpS6, PARP, cleaved-caspase 3, p21, p27, phospho-RB (Ser807/811), RB, CDK2, β-actin, β-tubulin and GAPDH were all purchased from Cell Signaling Technology (Cambridge, MA, USA).
Xu L.S., Zheng S.X., Mei L.H., Yang K.X., Wang Y.F., Zhou Q., Kong X.T., Zheng M.Y., Jiang H.L, & Xie C.Y. (2023). 143D, a novel selective KRASG12C inhibitor exhibits potent antitumor activity in preclinical models. Acta pharmacologica Sinica, 44(7).
+ Open protocol
+ Expand
9

Afatinib Impacts Erythrocyte Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fresh Li-Heparin-anticoagulated blood samples were kindly provided by the blood bank of the University of Tübingen. The study is approved by the ethics committee of the University of Tübingen (184/2003 V). The blood was centrifuged at 120 g for 20 min at 21 °C and the platelets and leukocytes-containing supernatant was disposed. Erythrocytes were incubated in vitro at a hematocrit of 0.4% in Ringer solution containing (in mM) 125 NaCl, 5 KCl, 1 MgSO 4 , 32 N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES; pH 7.4), 5 glucose, 1 CaCl 2 , at 37°C for 48 hours. Where indicated, erythrocytes were exposed for 48 hours to afatinib (MedChem Express, Princeton, USA). In order to estimate the impact of Ca 2+ entry on afatinib induced phosphatidylserine exposure, ROS and ceramide formation, erythrocytes were exposed to afatinib in the absence and presence of extracellular Ca 2+ . To explore the participation of Akt/ PKB signaling pathway, erythrocytes were exposed for 48 hours to a combination of afatinib and Akt1/2 kinase inhibitor A6730 (58nM) (Sigma Aldrich Germany),
Al Mamun Bhuyan A, & Lang F. (2018). Stimulation of Eryptosis by Afatinib. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 47(3).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!