Rnasy mini kit

Manufactured by Qiagen

Sourced in Germany, United States

The RNeasy Mini Kit is a product by Qiagen designed for the isolation and purification of high-quality RNA from a variety of sample types. It utilizes a silica-membrane technology to efficiently capture and purify RNA, making it suitable for downstream applications such as RT-PCR, Northern blotting, and microarray analysis.

Automatically generated - may contain errors

Lab products found in correlation

Quantitect reverse transcription kit, by Qiagen (3 mentions) Primescript rt reagent kit, by Takara Bio (3 mentions) Rnase free dnase set, by Qiagen (2 mentions) Tri reagent, by Merck Group (2 mentions) Rt2 first strand kit, by Qiagen (2 mentions) Prostar hplc 218 system, by Agilent Technologies (2 mentions) X tremegene 9, by Roche (1 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Opti mem, by Thermo Fisher Scientific (1 mentions) Mmessage mmachine t7 transcription kit, by Merck Group (1 mentions) Mirpremier microrna isolation kit, by Merck Group (1 mentions) Mmessage mmachine t7 transcription kit, by Qiagen (1 mentions) Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Primer blast, by Thermo Fisher Scientific (1 mentions) Truseq stranded total rna sample prep kit, by Illumina (1 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions) Hiseq 2500 platform, by Illumina (1 mentions) Power sybr green master mix, by Thermo Fisher Scientific (1 mentions) Qiashredder column, by Qiagen (1 mentions) Lightcycler 480 sybr green 1 master, by Roche (1 mentions)

Spelling variants of this product

Mini Kits (17 citations) RNasy kit (16 citations) RNasy Plus Mini Kit (5 citations) RNasy plant mini kit (4 citations)

27 protocols using rnasy mini kit

RNA Extraction from M. tuberculosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After two weeks of culturing of H37Rv strain and patients specimens in 7H9 broth medium and adjusting the turbidity of broth medium, in compliance with no.4 McFarland standard (Barium Sulfate suspension=1.2× 109 cell/ml), RNA extraction was performed with the following protocol:
About 5 ml of specimen cultures were centrifuged at 5000 g for 5 min at 4°C. Supernatant was decanted and the remaining media were carefully removed. Precipitations were dissolved in TE buffer (1 mM EDTA and 10 mM Tris-HCl) and mixed by pipetting. Then, they were centrifuged at 5000 g for 5 min at 4°C and precipitations dissolved in lysis buffer (RLT buffer in Qiagen RNasy Mini kit) were recovered and vortexed for 10 min with glass beads included (dropped) in the solution. During this step, heating (85°C) was used to increase the efficacy of lysis buffer because of M. tuberculosis cell wall. After lysing cell wall, the extraction of RNA continued according to the Qiagen RNasy Mini kit. The extracted RNA was stored at 80°C until it was used for concurrent amplifications by NASBA.

Ramezani R., Forouzandeh Moghadam M, & Rasaee M.J. (2019). Development of Sensitive and Rapid RNA Transcription-based Isothermal Amplification Method for Detection of Mycobacterium tuberculosis. Avicenna Journal of Medical Biotechnology, 11(2), 169-175.

+ Open protocol

+ Expand

Detecting NBS1 Gene Expression in CHO Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transcription of the NBS1 gene was detected after transient transfection of the BAC/NBS1-containing DNA into hypoxanthine phosphoribosyltransferase (HPRT)-deficient Chinese hamster ovary (CHO) cells by RT-PCR. CHO cells in a 6-well plate at 70% confluent were transfected with 2 μg of BAC/NBS1 DNA (∼70 kb) with 6 μl of XtremeGENE 9 (Roche, Cat# 06–365–787–001) in 200 μl of Optimem (Life Technologies, Cat# 11058021). Cells were scraped off the plate in PBS, 48 h after transformation. Whole RNA was extracted using a RNasy Mini Kit (Qiagen, Cat# 74104) with RNAse-Free DNAse Set (Qiagen, Cat# 79254). The protocol used was as recommended by the manufacturer. Cells were lysed using a syringe and a 27 gauge needle. cDNA was made using M-MLV Reverse Transcriptase (Life Technologies, Cat# 28025–013). RT-PCR used human specific NSB1 primers listed in Supplementary Table S1. The PCR products were sequenced by ACGT Inc.

Lee N.C., Larionov V, & Kouprina N. (2015). Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast. Nucleic Acids Research, 43(8), e55.

+ Open protocol

+ Expand

CRISPR-Mediated lncRNA Knockout in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

LncRNA knockout models were produced in the Transgenic Unit of the Institute of Molecular Genetics ASCR, Czech Centre for Phenogenomics using Cas9-mediated deletion of lncRNA promoters (Supplementary Figs. S7 and S8).¹⁵ (link)^,¹⁶ All animal experiments were approved by the Institutional Animal Use and Care Committees (project number 58-2015) and were carried out in accordance with the law.
Sequences of guide RNAs are listed in the Table S5. To produce guide RNAs, synthetic 128 nt guide RNA templates including T7 promoter, 18 nt sgRNA and tracrRNA sequences were amplified using T7 and TracrRNA primers (Supplementary Table S5). Guide RNAs were produced in vitro using the Ambion mMESSAGE mMACHINE T7 Transcription Kit, and purified using the mirPremier microRNA Isolation Kit (Sigma). The Cas9 mRNA was synthesized from pSp Cas9-puro plasmid using Ambion mMESSAGE mMACHINE T7 Transcription Kit, and purified using the Qiagen RNasy mini kit. A sample for microinjection was prepared by mixing two guide RNAs in ultra-pure water at a concentration of 25 ng/µl for each one together with Cas9 RNA (100 ng/µl) . Five picoliters of the microinjection mixture were injected into male pronuclei of C57Bl/6 zygotes and transferred into pseudopregnant recipient mice. PCR genotyping was performed on tail biopsies from 4 weeks-old animals. Primers are listed in Supplementary Table S5.

Karlic R., Ganesh S., Franke V., Svobodova E., Urbanova J., Suzuki Y., Aoki F., Vlahovicek K, & Svoboda P. (2017). Long non-coding RNA exchange during the oocyte-to-embryo transition in mice. DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes, 24(2), 129-141.

+ Open protocol

+ Expand

Transcriptome Profiling via Magnetic Probe

Check if the same lab product or an alternative is used in the 5 most similar protocols

Totally, 1 × 10⁷ cells were gotten, subjected to lysis and ultrasonic breaking. The BC083743 probe was cultivated with CMurl-1 magnet beads (Life Technology, California, USA) under 25°C for 2 hours to make beads coated with probes. The cellular lysate involving the BC083743 probe or oligonucleotide probe was cultivated under 4°C for one night. Since a washing buffer was used to wash, RNA mix was escaped with RNasy Minikit (QIAGEN, Germany) for QRT-PCR or timely PCR.

Lu F, & Tang L. (2022). LncRNA BC083743 Silencing Exacerbated Osteoporosis by Regulating the miR-103-3p/SATB2 Axis to Inhibit Osteogenic Differentiation. Computational Intelligence and Neuroscience, 2022, 7066759.

+ Open protocol

+ Expand

Comparative Gene Expression in Pathogenic Amoebae

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from trophozoites and cysts (or precysts) of N. fowleri, A. castellanii, and A. polyphaga were prepared using an isolation kit Rnasymini kit (QIAGEN, Hilden, Germany); cDNAs were synthesized from 10 μg of total RNA using cDNA Synthesis kit (Invitrogen, Carlsbad, California, USA). RT-PCR was performed using specific primer for nfa1 and nf-actin genes for Naegleria, and actin and atg8 genes for Acanthamoeba [5 (link),14 (link), 15 (link)]. The reference genes were the p3 gene (N. fowleri-specific chromosomal DNA sequence; forward 5′GCTATCGAATGGATTCAAGC and reverse 5′CACTACTCGTGGAAGGCTTA) and 18S rRNA gene [5 (link)]. PCR condition was 95°C for 5 min, 30 cycles at 95°C for 1 min, 50–55°C for 1 min, 72°C for 1 min, and final extension for 10 min at 72°C.

Sohn H.J., Kang H., Seo G.E., Kim J.H., Jung S.Y, & Shin H.J. (2017). Efficient Liquid Media for Encystation of Pathogenic Free-Living Amoebae. The Korean Journal of Parasitology, 55(3), 233-238.

+ Open protocol

+ Expand

Comprehensive RNA-seq and RT-qPCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was prepared as already reported13 (link). For RNA-seq samples were treated with DNasi (NEB), purified with RNasy Mini Kit (Qiagen) and controlled with Agilent 2100 bioanalyzer (Agilent Technologies). RNAs, 3 μg/each obtained from three biological replicates, were pooled to minimize sample-to-sample variations. 1 μg of each RNA pool was used for library preparation with TruSeq Stranded total RNA Sample Prep Kit (Illumina Inc.) according to the manufacturer’s instructions. Libraries were sequenced in triplicates (paired-end, 2 × 100 cycles) at a concentration of 8 pmol/L per lane on HiSeq2500 platform (Illumina Inc.).
The generated raw sequence files (.fastq files) underwent quality control analysis using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and will be available at the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress.).
RT-qPCR and primer design were conducted as already described13 (link) using QuantiTect Reverse Transcription Kit (QIAGEN), Power SYBR Green Master Mix (Applied Biosystems with Applied Biosystem 7900 Real-Time PCR System) and NCBI Primer Blast, respectively. See Supplementary Table S1 for primer sequences. The expression values were normalized on the relative expression of Gapdh.

Porreca I., D’Angelo F., De Franceschi L., Mattè A., Ceccarelli M., Iolascon A., Zamò A., Russo F., Ravo M., Tarallo R., Scarfò M., Weisz A., De Felice M., Mallardo M, & Ambrosino C. (2016). Pesticide toxicogenomics across scales: in vitro transcriptome predicts mechanisms and outcomes of exposure in vivo. Scientific Reports, 6, 38131.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell lysates were homogenized with the QiaShredder Column (Qiagen) and total cellular RNA was extracted using RNasy Mini kit (Qiagen) following the manufacturer’s instructions. Equal amounts of RNA (1 µg) were used for reverse transcription using the Primescript RT Reagent kit (Takara Bio) following the manufacturer’s instructions. cDNA was then diluted 1:20 and amplified in quantitative PCR which was monitored using Lightcycler 480 SYBR Green I Master (Roche Diagnostics, Belgium) in a LightCycler 480 Real-Time PCR System thermocycler (Roche Applied Science) and the results were analyzed using the ΔΔC_T method. The primers used were as follows: GAPDH 5′-AGCCACATCGCTCAGACAC-3′ (forward), 5′-GCCCAATACGACCAAAT CC-3′ (reverse); SOCS3 5′-CTTCGACTGCGTGCTAA-3′ (forward), 5′-GTAGGTGGCGAGGGG AAG-3′ (reverse); 2′5′OAS 5′-GACGGATGTTAGCCTGCTG-3′ (forward), 5′-TGGGGATTTGG TTTGGTG-3′ (reverse); IFITM1 5′-CACGCAGAAAACCACACTTC-3′ (forward), 5′-TGTTCCT CCTTGTGCATCTTC-3′ (reverse); ISG54 5′-TGGTGGCAGAAGAGGAAGAT-3′ (forward), 5′-G TAGGCTGCTCTCCAAGGAA-3′ (reverse). The fold change of mRNA expression was calculated by normalizing the relative amount to the internal control GAPDH and comparing with untreated cells.

Mori R., Wauman J., Icardi L., Van der Heyden J., De Cauwer L., Peelman F., De Bosscher K, & Tavernier J. (2017). TYK2-induced phosphorylation of Y640 suppresses STAT3 transcriptional activity. Scientific Reports, 7, 15919.

+ Open protocol

+ Expand

Quantifying Gene Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNasy Mini Kit (Qiagen, Valencia, CA, USA) was used for total RNA isolation. Reverse transcription (RT) was carried out for 1 h at 55 °C with oligodeoxythymidylate primer using 5 μg of total RNA from each sample for complementary DNA synthesis.
Real time quantitative PCR to determine the levels of rat HIF1, HIF3, SOD1, GPX3 and housekeeping GAPDH mRNAs were performed using specific primers (See Table 1) synthesized at Sigma-Genosys (Oakville, ON, Canada).

Merino J.J., Roncero C., Oset-Gasque M.J., Naddaf A, & González M.P. (2014). Antioxidant and Protective Mechanisms against Hypoxia and Hypoglycaemia in Cortical Neurons in Vitro. International Journal of Molecular Sciences, 15(2), 2475-2493.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cell lysates using an RNasyMini Kit (Qiagen, Hilden, Germany) and reverse transcribed into cDNA with a ReverTra Ace qPCR RT Master Mix (TOYOBO, Osaka, Japan) following the operational instructions. The cDNA templates were mixed with iTaq Universal SYBR Green Supermix (Bio-rad, Hercules, CA, USA) and target genes primers (sequences listed in Table S1, see online supplementary material). Real-time PCR was performed using a Bio-Rad CFX96 Real-Time System.

Zhu Y., Chen X., Lu Y., Xia L., Fan S., Huang Q., Liu X, & Peng X. (2022). Glutamine mitigates murine burn sepsis by supporting macrophage M2 polarization through repressing the SIRT5-mediated desuccinylation of pyruvate dehydrogenase. Burns & Trauma, 10, tkac041.

+ Open protocol

+ Expand

Quantitative Analysis of Bacterial Biofilm and Virulence Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacterial biofilm-related genes (icaA, icaC, icaR, SigB), autolysis-related gene (SarA), cell wall synthesis-related genes (MurE, MurC, SaeR), resistance-related gene (MecA), and bacterial virulence-related genes (ssaA, Empb) were selected for quantitative analysis by RT-PCR. MRSA bacteria was centrifuged after incubation in LB broth medium for 12 h at 37 °C and resuspended in TRIzol regent containing 100 µg/mL lysostaphin. Total RNA was extracted using RNasy mini kit (Qiagen, Düsseldorf, Germany) and then converted to cDNA using PrimeScript RT reagent kit (TaKaRa) according to the manufacturer’s instructions. The RT-PCR reaction using cDNA templates were performed with TaKaRa TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus; RR820A) on QuantStudio1 applied biosystems. The cycle threshold values of all tested genes were normalized using GAPDH as reference gene, gene expressions were calculated by 2⁽⁻^ΔΔ^CT) method [67 (link)]. The primers [68 (link)] used are listed in Table S1.

Zhang W., Margarita G.E., Wu D., Yuan W., Yan S., Qi S., Xue X., Wang K, & Wu L. (2022). Antibacterial Activity of Chinese Red Propolis against Staphylococcus aureus and MRSA. Molecules, 27(5), 1693.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!