Engen sgrna synthesis kit

sgRNA was synthesized and purified using EnGen sgRNA Synthesis Kit and Monarch RNA Cleanup Kit, respectively as per manufacturer’s instructions (New England Biolabs- NEB). The newly formed sgRNA (180 pmol for 1.5x10⁷ cells) was mixed with 60 pmol EnGen Cas9 NLS, Streptococcus pyogenes (NEB) and incubated at 25°C for 10min. Subsequently the fresh precomplexed RNP was added at the cells previously resuspended at nucleofector solution (human T cell nucleofector kit, LONZA) and were immediately electroporated using the AMAXA Nucleofector II (Program T-007, Lonza).

For editing, the guide RNA (gRNA) sequence targeting the region surrounding the NAPB mutation was selected using CRISPR-Cas9 gRNA design tool (Integrated DNA technologies). Single guide RNA (sgRNA) was synthesized using EnGen sgRNA Synthesis Kit (NEB, E3322) according to the manufacturer’s instructions. Nucleofection was carried out using the Amaxa nucleofection system (P3 primary cell 4D-nucleofector kit, Cat#V4XP-3032) according to the manufacturer’s instructions. Briefly, RNP complex were generated by mixing 1 μg of sgRNA with 2 μM of EnGen SpyCas9 NLS (NEB, M0646) at room temperature for 15–20 min. Approximately 2.5–3 × 10⁵ iPSCs were electroporated using CB150 nucleofection program and plated onto Matrigel-coated plates. Approximately 2 μg of knock-in oligo (Supplementary Table S1) was added to the nucleofection mix just before nucleofection. The cleavage efficiency of sgRNA was evaluated using T7E1 cleavage assay. After 48 h the cells were diluted and plated as single cells on Matrigel-coated plates for 10–15 days to make colonies. Genomic DNA (gDNA) was extracted using quick extract genomic DNA extraction buffer (epicenter). The region of NAPB targeted by sgRNA was amplified with specific primers (Supplementary Table S1) using PCR-Master mix (Thermo Fisher Scientific) and knock-in was confirmed by sanger sequencing of the PCR product.

CRISPR‐Cas9 targeting was used for the generation of LRBA‐deficient CTLA‐4 Jurkat lines. CRISPR‐Cas9 target sites were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu), and in vitro sgRNA syntheses containing the relevant target site were performed using the EnGen sgRNA Synthesis Kit, S. pyogenes (NEB) according to the manufacturer's instructions. Transcribed sgRNAs were purified using the RNA Clean & Concentrator Kit (Zymo Research) following the manufacturer's instructions.
For generation of cell lines, 500 ng sgRNA and 2 μg Cas9 protein (TrueCut™ Cas9 Protein v2) were electroporated into 2 × 10⁵ target cells using the Neon™ Transfection System (Thermo Fisher Scientific) under the following conditions: voltage (1600 V), width (10 ms), pulses (three), 10 μl tip and Buffer R. Cells were allowed to recover for 3–5 days prior to screening for KO by flow cytometry. This approach generally yielded heterozygous and homozygous KO of the target gene in 70%‐95% of the cells.

Single guide RNA (sgRNA) was synthesized by using the EnGen sgRNA synthesis Kit (New England Biolabs, Ipswich, MA, USA) following standard protocols. DNA oligos (IDT) were designed to contain a T7 promoter sequence upstream of the target sequences with an initiating 5′- d(G), as well as overlapping tracrRNA DNA sequence at the 3′ end of the target. The sgRNA was purified using Monarch RNA Cleanup Kit (NEB) and quantitated using standard protocols.

The sgRNA for the sofT gene mutation was synthesized using the EnGen sgRNA Synthesis Kit (New England Biolabs, Frankfurt). Ribonucleoprotein (RNP) formation was carried out at 37°C for 20 min with 4 μl unpurified sgRNA, 10 μl Cas9 (200nM), 5 μl 10x Cas9 Nuclease Reaction Buffer and DEPC-treated water in 50 μl total volume. For protoplast transformation, the linear resistance gene hph was amplified by PCR, subsequently purified using FastGene Gel/PCR Extraction kit (Nippon Genetics) and lastly about 2 μg purified PCR-product were added to the transformation-mix. The transformation was carried out as described.

Guide RNA (gRNA) sequences targeting MALAT1 promoter region were described before^{45 (link)}. Two guides, guide-1 (GCTGGGGCTCAGTTGCGTAA) and guide-2 sequence (AGGTTTCTAAAACATGACGG) were in vitro synthesized using the EnGen sgRNA Synthesis Kit, S. pyogenes (NEB# E3322S). The in vitro transcribed guides were purified using Monarch RNA cleanup Kit (NEB# T2040L). Manufacturer’s instructions were followed for both the above-mentioned kits. The MALAT1 gRNA were each eluted in 20 μl of nuclease free water and immediately aliquotted into PCR tubes and stored at −80 °C until use. The concentrations of purified gRNA were measured using NanoDrop 2000 (Thermo Fisher Scientific).