The neutral comet assay was performed using the Comet Assay Kit (Trevigen, #4250-050-K) according to the manufacturer’s instructions. Briefly, HEK293T cells were cultured in 6-well plates and transfected with pCAG (Addgene, #11150) or ZCWPW1-pCAG using Lipofectamin 3000 Transfection Reagent (Invitrogen, # L3000001) following the manufacturer’s protocol. After 24 h, cells were treated with 2 mM hydroxyurea for 16 h. A total of 1 × 104 cells in 10 μl PBS were mixed with 100 μl 0.8% low-gelling agarose and were layered as microgels on microscope slides. Slides were then immersed in lysis solution at 4°C for 1–2 h in the dark. After lysis, the slides were incubated in alkaline unwinding solution for 20 minutes at room temperature. Electrophoresis was performed at neutral pH at 1 V/cm for 10–15 min. After neutralization, samples were stained with ethidium bromide for 10 min and imaged with an Olympus fluorescence microscope. DNA damage was quantified by measuring the comet tail length using Comet Assay Software Pect (CASP 1.2.3 beta 1).
Lipofectamin 3000 transfection reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States
Lipofectamin 3000 is a transfection reagent used for the delivery of nucleic acids, such as plasmid DNA, mRNA, or siRNA, into a variety of mammalian cell lines. It facilitates the uptake of these molecules by the cells, enabling their expression or silencing.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Comet assay kit, by Bio-Techne (1 mentions)
Fluorescence microscope, by Olympus (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
293tn cells, by System Biosciences (1 mentions)
Sic001, by Merck Group (1 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions)
Pcd5 cir, by Geneseed (1 mentions)
Dmem f12, by Thermo Fisher Scientific (1 mentions)
X tremegene hp dna transfection reagent, by Merck Group (1 mentions)
Penicillin streptomycin, by Lonza (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Effectene, by Qiagen (1 mentions)
Dulbecco modified eagle medium (dmem), by Lonza (1 mentions)
Streptomycin, by Qiagen (1 mentions)
Hiperfect, by Qiagen (1 mentions)
Caspase glo 3 7 assay, by Promega (1 mentions)
Lna gapmer, by Qiagen (1 mentions)
Doxorubicin, by Merck Group (1 mentions)
16 protocols using lipofectamin 3000 transfection reagent
1
Neutral Comet Assay for DNA Damage
2
Constructing MYCL Expression Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MYCL expression vector was constructed briefly. Sequences of MYCL were amplified from the cDNA of U266 cells using PCR primers and inserted into the HindIII/XhoI site of the pcDNA3.1 3xFLAG expression vector (Invitrogen, Carlsbad, California, USA). The primers were synthesized at a commercial laboratory (Invitrogen). The primers were as follows: MYCL vari1full EcoR1 F was GGAATTCCGACTACGACTCGTACCAGCACT and MYCL vari1-2full Xba1 R2 was GCTCTAGATGCACCGGCTGCAATGCATT , respectively. The MYCL construct was transfected into U266 cells (2×106 cells) using lipofectamin 3000 transfection reagent (Invitrogen). The controls were mock transfected with an empty vector.
3
Lentiviral Transduction of Huh7 and 293TN Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Huh7 HCC cell line was obtained from the Korea Cell Line Bank (KCLB; Seoul, Korea). 293TN cells were obtained from System Biosciences (Mountain View, CA, USA), and were cultured in DMEM supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin. Lentiviral constructs expressing non-target (NT) and BAP1 shRNAs were purchased from Sigma-Aldrich (SHCLNG-NM_004656; St. Louis, MO, USA), and transfected into 293TN cells (System Biosciences) with Lipofectamin 3000 transfection reagent (Invitrogen, Waltham, MA, USA). Two reaction tubes with 500 ul aliquots of opti-MEM (Invitrogen; A and B) were prepared. Tube A was added with 24 µl P3000 reagent and 8 ug of DNA (3 µg pGag-pol, 1 µg VSV-G, and 4 µg target plasmid). Tube B was added with 15 µl lipofectamin 3000. Then, the mixture of tube A to tube B was incubated for 5 min and added in small drops to the cells with 70–90% confluence. The particles were collected 2 days after transfection. The lentivirus-infected cells were puromycin-selected for 1 week and stabilized by culturing for 4 weeks.
4
STC2 knockdown using siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
STC2 siRNA and scrambled siRNA for negative control (Bioneer Co. Ltd, Daejeon, Korea) were used to induce STC2 knock-down. Cells were transfected with siRNAs using Lipofectamin™ 3000 Transfection reagent (Invitrogen, # L3000008), according to the manufacturer’s instructions. Synthetic siRNA oligomers were complexed with the transfection reagent in Opti-MEM, reduced serum medium, and added to cells. Cells were then used for the following assays 24 h-36 h after transfection.
5
Silencing Circular RNAs in Brain Cancers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific siRNAs targeting the back-spliced junction of FKBP8, SMARCA5, GLIS1, BACH1, ZKSCAN1, CDYL, and OGDH circRNAs (Supplementary Table S2 ) and control siRNAs (SIC001, Sigma-Aldrich, Merck, Darmstadt, Germany) were used. We have designed three siRNAs for CDYL, BACH1, and GLIS1 circRNAs, and two for OGDH, SMARCA5, ZKSCAN1, and FKBP8 circRNAs using online tools (https://horizondiscovery.com/en/ordering-and-calculation-tools/sidesign-center , https://circinteractome.irp.nia.nih.gov/siRNA_design.html , accessed on 2 March 2020).
For plasmid transfections, the full-length FKBP8, SMARCA5, GLIS1, BACH1, ZKSCAN1, CDYL, and OGDH circRNAs were amplified and cloned into the circRNA overexpression vector pCD5-ciR (GS0105, Geneseed, Guangzhou, China), with the empty vector used as a negative control.
Daoy and UW-228 cells were seeded in 96-well, 24-well, or 12-well plates at about 60% confluency, grown overnight until 70–80% confluent and transfected with 1 pmol siRNAs in 96-well plates, 5 pmol siRNAs in 24-well plates for 72 h, and 1000 ng plasmids in 12-well plates for 48 h. Lipofectamine RNAiMAX transfection reagent (Invitrogen, Waltham, MA, USA) was used for siRNA, and Lipofectamin 3000 transfection reagent (Invitrogen, Waltham, MA, USA) for plasmid transfections according to the manufacturer’s instructions.
For plasmid transfections, the full-length FKBP8, SMARCA5, GLIS1, BACH1, ZKSCAN1, CDYL, and OGDH circRNAs were amplified and cloned into the circRNA overexpression vector pCD5-ciR (GS0105, Geneseed, Guangzhou, China), with the empty vector used as a negative control.
Daoy and UW-228 cells were seeded in 96-well, 24-well, or 12-well plates at about 60% confluency, grown overnight until 70–80% confluent and transfected with 1 pmol siRNAs in 96-well plates, 5 pmol siRNAs in 24-well plates for 72 h, and 1000 ng plasmids in 12-well plates for 48 h. Lipofectamine RNAiMAX transfection reagent (Invitrogen, Waltham, MA, USA) was used for siRNA, and Lipofectamin 3000 transfection reagent (Invitrogen, Waltham, MA, USA) for plasmid transfections according to the manufacturer’s instructions.
6
Cell Culture and Transfection Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human epithelial carcinoma A431 cells and MEFs were cultured in DMEM (Lonza), and NPC1-deficient CHO M12 cells in DMEM/F-12 (1:1, Gibco) supplemented with 10% FBS (Gibco), penicillin/streptomycin (100 U/ml each, Lonza) and 2 mM L-glutamine (Gibco).
CHO cells were grown in Ham’s F12 medium (Shanghai Basalmedia Technologies Co., Ltd., L410) supplemented with 10% FBS (Gibco, 10270-106), penicillin 100 UI/ml, and streptomycin 100 ug/ml at 37 °C in a 5% CO2 incubator.
siRNAs were transfected in A431 cells with HiPerFect (Qiagen) for 72 h and cDNA constructs with Effectene (Qiagen) for 24 h according to the manufacturer’s instructions. Transfections of CHO M12 cells were carried with X-tremeGENE HP DNA transfection reagent (Sigma-Aldrich) for 48 h. Human LIMP-2 plasmids were transiently transfected using Lipofectamin 3000 transfection reagent (Invitrogen, 100022052) or Polyethylenimine (PEI, Polysciences Inc., 23966-2) using the manufacturers’ protocols.
CHO cells were grown in Ham’s F12 medium (Shanghai Basalmedia Technologies Co., Ltd., L410) supplemented with 10% FBS (Gibco, 10270-106), penicillin 100 UI/ml, and streptomycin 100 ug/ml at 37 °C in a 5% CO2 incubator.
siRNAs were transfected in A431 cells with HiPerFect (Qiagen) for 72 h and cDNA constructs with Effectene (Qiagen) for 24 h according to the manufacturer’s instructions. Transfections of CHO M12 cells were carried with X-tremeGENE HP DNA transfection reagent (Sigma-Aldrich) for 48 h. Human LIMP-2 plasmids were transiently transfected using Lipofectamin 3000 transfection reagent (Invitrogen, 100022052) or Polyethylenimine (PEI, Polysciences Inc., 23966-2) using the manufacturers’ protocols.
7
Apoptosis Screening in BRCA1P1-Knockdown Cells
8
Plasmid Transfection and Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells seed in 12-well plates, and the second day the mentioned plasmids were performed with Lipofectamin-3000 transfection reagent according to the manufacturer's instructions (Invitrogen). Brie y, 500ng of the corresponding plasmids and Lipofectamine 3000 reagent were diluted in 100µL Opti-MEM I reduced serum medium (Invitrogen) and the diluted plasmids were then added to the Lipofectamine 3000
(1:1 ratio), mixed, and incubated at room temperature for 10 min. The transfection mixture was then added to cells at 60-70%, and was replaced with esh 2% FBS DMEM after transfection 6h.
Western blotting HFF cells were seeded in 12-well plates with the density of 1.5 × 10 6 cells/ well. Until 85% cell con uence, cells were infected with HSV-1 (MOI = 20) at 37°C for 4 h. Therefore, DMEM maintenance medium with or without AT-533 or 17-AAG was added. At 12h post infection, the cells were washed three times with PBS, and were lysed with 1*SDS-PAGE buffer (Beyotime). The equal amount (40 µg/sample) proteins were subjected to Western Blot analysis.
(1:1 ratio), mixed, and incubated at room temperature for 10 min. The transfection mixture was then added to cells at 60-70%, and was replaced with esh 2% FBS DMEM after transfection 6h.
Western blotting HFF cells were seeded in 12-well plates with the density of 1.5 × 10 6 cells/ well. Until 85% cell con uence, cells were infected with HSV-1 (MOI = 20) at 37°C for 4 h. Therefore, DMEM maintenance medium with or without AT-533 or 17-AAG was added. At 12h post infection, the cells were washed three times with PBS, and were lysed with 1*SDS-PAGE buffer (Beyotime). The equal amount (40 µg/sample) proteins were subjected to Western Blot analysis.
9
Kaempferol Modulates H9C2 Cell Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat immortalized myocardial H9C2 cell line was purchased from the Shanghai cell bank of Chinese Academy of Sciences; kaempferol was from Sigma-Aldrich Company (United States of America [USA]); cell counting kit 8 (CCK8) was obtained from Qihai Biology Company (Shanghai, China); Dulbecco’s Modified Eagle’s Medium (DMEM), trypsin, penicillin, and streptomycin from Hyclone Company (USA); fetal bovine serum, protein quantitative kit, and Lipofectamin 3000 transfection reagent were collected from Thermo Fisher Scientific Inc. (USA); SIRT3 short interfering ribonucleic acid (siRNA) was designed and synthesized by Gemma company (Shanghai, China); cell culture bottles, Petri dishes, and centrifuge tubes were brought from Corning company (USA); SIRT3, SOD2, B-cell lymphoma 2 (Bcl2), BCL2-associated X protein (Bax), and β-actin antibodies were from Cell Signaling Technology (USA); goat anti-mouse and goat anti-rabbit second antibodies were obtained from Zhongshan Jinqiao Biological Company (Beijing, China); reactive oxygen species (ROS), glutathione (GSH), and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase kit were purchased from Nanjing Jiancheng Institute of Bioengineering (Nanjing, China); and Western blot equipment, light-emitting photography system was purchased from Bio-Rad Company (USA).
10
Transfecting hMSCs with miRNA Mimic
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection of miRNA mimic in hMSCs was performed using the Lipofectamin 3000 Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. Cells were plated in 12-well plates; 24 h after seeding, when cells were 70% confluent, cells were transfected with 30pmoles/mL of hsa-129-5p mimic (cat.number 4464066, Life Technologies), or scrambled negative control (4464058, Life Technologies). Twenty-four, 48 and 72 h after transfection, the medium was collected and the cells processed for RNA isolation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!