Taqman pcr core reagent kit

Total RNA from striatum of Hdh^(CAG)150 mice (heterozygous, n = 8) and WT littermates (n = 8) at 16 months of age was extracted using the Trizol (Invitrogen, Carlsbad, CA, USA), and reverse transcribed into cDNA using SuperScript^TM III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). QRT-PCR was performed on a cDNA amount equivalent to 100 ng total RNA using the TaqMan PCR Core Reagent Kit and the Sequence Detection system (ABI Prism 7900, Applied Biosystems, Foster City, CA, USA). Primers (forward primer 5′-CCTAAGGACAGCAGTGGGC-3′, reverse primer 5′-CCCGATCGGACTTTGA-3′) and TaqMan probe (CTCCAGATGCAGACGAGCTT) designed by using Primer Express software, Version 2.0, Applied Biosystems were used for amplification of Aco2 cDNA. Primers Mm00446968_m1 and TaqMan probe (GGTTAAGGTTGCAAGCTTGCTGGTG) were used in QRT-PCR for Hprt1. Relative gene expressions were calculated using the 2^ΔCt method, ΔC_t = C_t (Hprt1) − C_t (Aco2), in which C_t indicates cycle threshold (the fractional cycle number where the fluorescent signal reaches detection threshold). Hprt1 was used as an internal control. Aco2 mRNA was measured in duplicate for each sample.

Human B cells were positively selected from PBMC with CD19 MACS beads (Miltenyi Biotec) and differentiated into IgG-secreting cells by coculture with CD40L-transfected mouse L cells and recombinant human IL-21 as described above. CD27⁺⁺CD38⁺ and CD38⁻ cells were sorted using the BD FACS Aria cell sorting system (Becton Dickinson, Heidelberg, Germany). For quantitative PCR analysis, RNA was isolated using the RNeasy Micro Kit (Qiagen, Hilden, Germany) and cDNA was generated using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Darmstadt, Germany). To detect BCMA transcripts, primer and probes were used as published41 (link). As housekeeping gene Cyclophilin A (PPIA) was used and detected with the primer and probes 43263416E from Applied Biosystems. Reactions were carried out in duplicate using TaqMan assays in combination with the TaqMan PCR Core Reagent Kit (Applied Biosystems). Samples were run in MicroAmp Optical 96-well reaction plates in a 7900HT Fast Real-Time PCR System (Applied Biosystems). Data were analysed using the SDSv2.3 software (Applied Biosystems).